RchiOBHm_Chr5g0017221

essential for photochemical activity. FB is the terminal electron acceptor of PSI, donating electrons to ferredoxin. The C-terminus interacts with PsaA B D and helps assemble the protein into the PSI complex. Required for binding of PsaD and PsaE to PSI. PSI is a plastocyanin-ferredoxin oxidoreductase, converting photonic excitation into a charge separation, which transfers an electron from the donor P700 chlorophyll pair to the spectroscopically characterized acceptors A0, A1, FX, FA and FB in turn

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Forward (+)
11958529 .. 11958774
246 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 246 bp
ATGTCACACTCAGTAAAGATTTATGATACGTGTATAGGGTGTACTCAATGTGTGCGAGCCTGCCCAACCGATGTATTAGAAATGATACCTTGGGACGGATGTAAAGCTAAGCAAATCGCTTCTGCTCCAAGAACAGAGGACTGTGTCGGTTGTAAGAGATGTGAATCCGCCTGTCCAACGGATTTCTTGAGTGTTCGCGTTTATTTATGGCATGAAACAACTCGAAGTATGGGTCTAGCTTATTAA

Protein Analysis

81

Amino Acids

9.04

Weight (kDa)

6.68

Isoelectric Point (pI)

54.05

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Fer4 PF00037 6 - 26 3.3e-07 4Fe-4S binding domain
Fer4_21 PF14697 9 - 62 7.1e-11 4Fe-4S dicluster domain
Fer4_7 PF12838 10 - 61 1.6e-10 4Fe-4S dicluster domain
Fer4_9 PF13187 11 - 61 3.9e-07 4Fe-4S dicluster domain
Fer4 PF00037 45 - 63 1.1e-06 4Fe-4S binding domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0020888)

Species Orthologous Gene IDs
arabidopsis_thaliana ATCG01060
rosa_chinensis RchiOBHm_Chr5g0017221 RchiOBHm_Chr5g0043041 RchiOBHm_CPg0502781
rosa_wichuraiana Rw7G038430

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 198
AciI CCGC 1 cut(s) 168
AfaI GTAC 1 cut(s) 43
AfiI CCNNNNNNNGG 1 cut(s) 95
AflIII ACRYGT 1 cut(s) 29
AluBI AGCT 2 cut(s) 107, 239
AluI AGCT 2 cut(s) 107, 239
ArsI GACNNNNNNTTYG 1 cut(s) 217
BfaI CTAG 1 cut(s) 236
BlpI GCTNAGC 1 cut(s) 108
Bpu1102I GCTNAGC 1 cut(s) 108
BpuEI CTTGAG 1 cut(s) 208
BsaAI YACGTR 1 cut(s) 30
BsaBI GATNNNNATC 1 cut(s) 163
BsaJI CCNNGG 1 cut(s) 89
Bsc4I CCNNNNNNNGG 1 cut(s) 95
Bse8I GATNNNNATC 1 cut(s) 163
BseDI CCNNGG 1 cut(s) 89
BseGI GGATG 1 cut(s) 104
BseJI GATNNNNATC 1 cut(s) 163
BseLI CCNNNNNNNGG 1 cut(s) 95
BseMII CTCAG 1 cut(s) 24
Bsh1236I CGCG 1 cut(s) 198
BslFI GGGAC 1 cut(s) 107
BslI CCNNNNNNNGG 1 cut(s) 95
BsmFI GGGAC 1 cut(s) 107
Bsp1720I GCTNAGC 1 cut(s) 108
BspACI CCGC 1 cut(s) 168
BspCNI CTCAG 1 cut(s) 23
BspFNI CGCG 1 cut(s) 198
BssECI CCNNGG 1 cut(s) 89
BssT1I CCWWGG 1 cut(s) 89
Bst4CI ACNGT 1 cut(s) 143
BstBAI YACGTR 1 cut(s) 30
BstC8I GCNNGC 2 cut(s) 57, 61
BstDEI CTNAG 2 cut(s) 10, 108
BstF5I GGATG 1 cut(s) 104
BstFNI CGCG 1 cut(s) 198
BstUI CGCG 1 cut(s) 198
BtsCI GGATG 1 cut(s) 104
Cac8I GCNNGC 2 cut(s) 57, 61
Csp6I GTAC 1 cut(s) 42
CviAII CATG 1 cut(s) 212
CviJI RGCY 3 cut(s) 59, 107, 239
CviKI_1 RGCY 3 cut(s) 59, 107, 239
CviQI GTAC 1 cut(s) 42
DdeI CTNAG 2 cut(s) 10, 108
EciI GGCGGA 1 cut(s) 157
Eco130I CCWWGG 1 cut(s) 89
EcoT14I CCWWGG 1 cut(s) 89
ErhI CCWWGG 1 cut(s) 89
FaeI CATG 1 cut(s) 215
FaiI YATR 5 cut(s) 24, 35, 208, 213, 230
FaqI GGGAC 1 cut(s) 107
FatI CATG 1 cut(s) 211
FokI GGATG 1 cut(s) 111
FspBI CTAG 1 cut(s) 236
Hin1II CATG 1 cut(s) 215
HinfI GANTC 1 cut(s) 164
Hpy166II GTNNAC 1 cut(s) 42
Hpy188III TCNNGA 1 cut(s) 187
Hpy8I GTNNAC 1 cut(s) 42
HpyCH4III ACNGT 1 cut(s) 143
HpyCH4IV ACGT 1 cut(s) 29
HpyF3I CTNAG 2 cut(s) 10, 108
HpySE526I ACGT 1 cut(s) 29
Hsp92II CATG 1 cut(s) 215
LmnI GCTCC 1 cut(s) 130
LpnPI CCDG 2 cut(s) 73, 184
MaeI CTAG 1 cut(s) 236
MaeII ACGT 1 cut(s) 29
MaeIII GTNAC 1 cut(s) 3
MmeI TCCRAC 1 cut(s) 200
MnlI CCTC 1 cut(s) 130
MseI TTAA 1 cut(s) 244
MvnI CGCG 1 cut(s) 198
NlaIII CATG 1 cut(s) 215
NmuCI GTSAC 1 cut(s) 3
PfeI GAWTC 1 cut(s) 164
PflFI GACNNNGTC 1 cut(s) 143
Ppu21I YACGTR 1 cut(s) 30
PsyI GACNNNGTC 1 cut(s) 143
RsaI GTAC 1 cut(s) 43
RsaNI GTAC 1 cut(s) 42
SaqAI TTAA 1 cut(s) 244
SetI ASST 4 cut(s) 32, 91, 109, 241
SmlI CTYRAG 1 cut(s) 187
SmoI CTYRAG 1 cut(s) 187
SsiI CCGC 1 cut(s) 168
SspMI CTAG 1 cut(s) 236
StyI CCWWGG 1 cut(s) 89
TaaI ACNGT 1 cut(s) 143
TaiI ACGT 1 cut(s) 32
TaqI TCGA 1 cut(s) 223
TatI WGTACW 1 cut(s) 41
TfiI GAWTC 1 cut(s) 164
Tru1I TTAA 1 cut(s) 244
Tru9I TTAA 1 cut(s) 244
TseFI GTSAC 1 cut(s) 3
Tsp45I GTSAC 1 cut(s) 3
TspDTI ATGAA 1 cut(s) 228
TspGWI ACGGA 2 cut(s) 111, 194
Tth111I GACNNNGTC 1 cut(s) 143
XspI CTAG 1 cut(s) 236
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.