RchiOBHm_Chr5g0021491

Vacuolar-sorting receptor

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
OG0030184
Physical Location & Seq
Reverse (-)
15670821 .. 15672057
1237 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 360 bp
ATGAAAGAAAAGCGTTACAGTAAAGAATGTGCTGAGGATGTCATGAAATCACTTGATTTGCCTATTGACCAGATAAAAAAATGCATGGCCAATCCTGAAGATGATGTGGAGAAAGAAGTGCTTAAAGCTGAACAAGAAATCCAGGTTGGTCGAGGATCTCGTGGTGATGTTACCATCTTGCCAACATTGGTGCTTAAGAATGTTCAATATCGAGGAAAACTGGAACGAAGTGGGGTCCTAAAGGCGGTATGTGCTGGATTCAAGGAGACAACTGAACCCCAAATTTGTTTGAACGGAGGTGAGCCTTTTGAGGTTTGGATAATGTACTTGAAAGGAATCAACAAAACTTACAGTTTATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
PA cEGF

Protein Analysis

119

Amino Acids

13.45

Weight (kDa)

6.35

Isoelectric Point (pI)

37.86

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
VSR_TRX PF25011 1 - 84 3.8e-27 Vacuolar sorting receptor thioredoxin-like domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0030184)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr5g0021491
rosa_samantha Rh5CG169800

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 245
AclWI GGATC 1 cut(s) 163
AcoI YGGCCR 1 cut(s) 87
AcsI RAATTY 1 cut(s) 282
AcuI CTGAAG 1 cut(s) 117
AfaI GTAC 1 cut(s) 326
AfiI CCNNNNNNNGG 1 cut(s) 244
AflII CTTAAG 1 cut(s) 194
AgsI TTSAA 4 cut(s) 206, 262, 292, 331
AjnI CCWGG 1 cut(s) 141
AjuI GAANNNNNNNTTGG 2 cut(s) 129, 161
AloI GAACNNNNNNTCC 2 cut(s) 123, 155
AluBI AGCT 1 cut(s) 128
AluI AGCT 1 cut(s) 128
Alw26I GTCTC 1 cut(s) 260
AlwI GGATC 1 cut(s) 163
AoxI GGCC 1 cut(s) 87
ApoI RAATTY 1 cut(s) 282
AspS9I GGNCC 1 cut(s) 235
AsuHPI GGTGA 2 cut(s) 176, 311
AvaII GGWCC 1 cut(s) 235
BalI TGGCCA 1 cut(s) 89
BauI CACGAG 1 cut(s) 159
BbvCI CCTCAGC 1 cut(s) 33
BccI CCATC 1 cut(s) 182
BciT130I CCWGG 1 cut(s) 143
BcoDI GTCTC 1 cut(s) 260
BfrI CTTAAG 1 cut(s) 194
Bme1390I CCNGG 1 cut(s) 143
Bme18I GGWCC 1 cut(s) 235
BmgT120I GGNCC 1 cut(s) 235
BmiI GGNNCC 1 cut(s) 236
BmrFI CCNGG 1 cut(s) 143
Bpu10I CCTNAGC 1 cut(s) 33
Bsc4I CCNNNNNNNGG 1 cut(s) 244
Bse1I ACTGG 1 cut(s) 225
BseBI CCWGG 1 cut(s) 143
BseGI GGATG 1 cut(s) 43
BseLI CCNNNNNNNGG 1 cut(s) 244
BseMII CTCAG 1 cut(s) 24
BseNI ACTGG 1 cut(s) 225
BshFI GGCC 1 cut(s) 89
BslI CCNNNNNNNGG 1 cut(s) 244
BsmAI GTCTC 1 cut(s) 260
BsnI GGCC 1 cut(s) 89
Bsp143I GATC 1 cut(s) 155
BspACI CCGC 1 cut(s) 245
BspANI GGCC 1 cut(s) 89
BspCNI CTCAG 1 cut(s) 25
BspHI TCATGA 1 cut(s) 42
BspLI GGNNCC 1 cut(s) 236
BspPI GGATC 1 cut(s) 163
BspTI CTTAAG 1 cut(s) 194
BsrI ACTGG 1 cut(s) 225
BssMI GATC 1 cut(s) 155
BssSI CACGAG 1 cut(s) 159
Bst2BI CACGAG 1 cut(s) 159
Bst2UI CCWGG 1 cut(s) 143
Bst4CI ACNGT 2 cut(s) 20, 353
BstAFI CTTAAG 1 cut(s) 194
BstDEI CTNAG 1 cut(s) 33
BstF5I GGATG 1 cut(s) 43
BstKTI GATC 1 cut(s) 158
BstMAI GTCTC 1 cut(s) 260
BstMBI GATC 1 cut(s) 155
BstMWI GCNNNNNNNGC 1 cut(s) 251
BstNI CCWGG 1 cut(s) 143
BstSCI CCNGG 1 cut(s) 141
BstX2I RGATCY 1 cut(s) 155
BstYI RGATCY 1 cut(s) 155
BsuRI GGCC 1 cut(s) 89
BtsCI GGATG 1 cut(s) 43
CciI TCATGA 1 cut(s) 42
Cfr13I GGNCC 1 cut(s) 235
Csp6I GTAC 1 cut(s) 325
CviAII CATG 2 cut(s) 43, 85
CviJI RGCY 3 cut(s) 89, 128, 304
CviKI_1 RGCY 3 cut(s) 89, 128, 304
CviQI GTAC 1 cut(s) 325
DdeI CTNAG 1 cut(s) 33
DpnI GATC 1 cut(s) 157
DpnII GATC 1 cut(s) 155
EaeI YGGCCR 1 cut(s) 87
Eco47I GGWCC 1 cut(s) 235
Eco57I CTGAAG 1 cut(s) 117
EcoO109I RGGNCCY 1 cut(s) 235
EcoRII CCWGG 1 cut(s) 141
EcoT22I ATGCAT 1 cut(s) 86
FaeI CATG 2 cut(s) 46, 88
FaiI YATR 4 cut(s) 44, 86, 250, 358
FalI AAGNNNNNCTT 2 cut(s) 105, 137
FatI CATG 2 cut(s) 42, 84
FokI GGATG 1 cut(s) 50
HaeIII GGCC 1 cut(s) 89
Hin1II CATG 2 cut(s) 46, 88
HinfI GANTC 2 cut(s) 258, 336
HphI GGTGA 2 cut(s) 176, 311
Hpy188III TCNNGA 2 cut(s) 43, 95
HpyCH4III ACNGT 2 cut(s) 20, 353
HpyCH4V TGCA 1 cut(s) 84
HpyF10VI GCNNNNNNNGC 1 cut(s) 251
HpyF3I CTNAG 1 cut(s) 33
Hsp92II CATG 2 cut(s) 46, 88
Kzo9I GATC 1 cut(s) 155
LpnPI CCDG 6 cut(s) 83, 108, 128, 155, 206, 240
MaeIII GTNAC 2 cut(s) 14, 169
MalI GATC 1 cut(s) 157
MboI GATC 1 cut(s) 155
MboII GAAGA 1 cut(s) 110
MflI RGATCY 1 cut(s) 155
MlsI TGGCCA 1 cut(s) 89
MluCI AATT 1 cut(s) 282
MluNI TGGCCA 1 cut(s) 89
MnlI CCTC 5 cut(s) 28, 146, 206, 290, 304
Mox20I TGGCCA 1 cut(s) 89
Mph1103I ATGCAT 1 cut(s) 86
MscI TGGCCA 1 cut(s) 89
MseI TTAA 2 cut(s) 123, 195
Msp20I TGGCCA 1 cut(s) 89
MspCI CTTAAG 1 cut(s) 194
MspR9I CCNGG 1 cut(s) 143
MvaI CCWGG 1 cut(s) 143
MwoI GCNNNNNNNGC 1 cut(s) 251
NdeII GATC 1 cut(s) 155
NlaIII CATG 2 cut(s) 46, 88
NlaIV GGNNCC 1 cut(s) 236
NsiI ATGCAT 1 cut(s) 86
PagI TCATGA 1 cut(s) 42
PcsI WCGNNNNNNNCGW 1 cut(s) 157
PfeI GAWTC 2 cut(s) 258, 336
PpuMI RGGWCCY 1 cut(s) 235
Psp5II RGGWCCY 1 cut(s) 235
Psp6I CCWGG 1 cut(s) 141
PspGI CCWGG 1 cut(s) 141
PspN4I GGNNCC 1 cut(s) 236
PspPI GGNCC 1 cut(s) 235
PspPPI RGGWCCY 1 cut(s) 235
PsuI RGATCY 1 cut(s) 155
RsaI GTAC 1 cut(s) 326
RsaNI GTAC 1 cut(s) 325
SaqAI TTAA 2 cut(s) 123, 195
Sau3AI GATC 1 cut(s) 155
Sau96I GGNCC 1 cut(s) 235
ScrFI CCNGG 1 cut(s) 143
SetI ASST 4 cut(s) 130, 147, 301, 315
SinI GGWCC 1 cut(s) 235
SmlI CTYRAG 1 cut(s) 194
SmoI CTYRAG 1 cut(s) 194
Sse9I AATT 1 cut(s) 282
SsiI CCGC 1 cut(s) 245
StyD4I CCNGG 1 cut(s) 141
TaaI ACNGT 2 cut(s) 20, 353
TaqI TCGA 2 cut(s) 151, 211
TasI AATT 1 cut(s) 282
TatI WGTACW 1 cut(s) 324
TfiI GAWTC 2 cut(s) 258, 336
Tru1I TTAA 2 cut(s) 123, 195
Tru9I TTAA 2 cut(s) 123, 195
TspDTI ATGAA 2 cut(s) 17, 59
TspGWI ACGGA 1 cut(s) 309
Vha464I CTTAAG 1 cut(s) 194
VpaK11BI GGWCC 1 cut(s) 235
XapI RAATTY 1 cut(s) 282
Zsp2I ATGCAT 1 cut(s) 86
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.