Rh5CG169800

Vacuolar-sorting receptor

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5C
Physical Location & Seq
Reverse (-)
15819068 .. 15843219
24152 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5CG169800.1

Sequence Viewer

Length: 249 bp
ATGAAAGAAAAGCGTTACAGTAAAGAATGTGCTGAGGATGTCATGAAATCACTTGATTTGCCTATTGACCAGATAAAAAAATGCATGGCCAATCCTGAAGATGATGTGGAGAAAGAAGTGCTTAAAGCTGAACAAGAAATCCAGGTTGGTCGAGGATCTCGTGGTGATGTTACCATCTTGCCAACATTGGTGCTTAAGAATGTTCAATATCGAGGGGAGAAATATGCTACCGATGGAGAAAATAGCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

82

Amino Acids

9.3

Weight (kDa)

4.99

Isoelectric Point (pI)

35.55

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
VSR_TRX PF25011 1 - 73 6.1e-22 Vacuolar sorting receptor thioredoxin-like domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0030184)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr5g0021491
rosa_samantha Rh5CG169800

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 163
AcoI YGGCCR 1 cut(s) 87
AcuI CTGAAG 1 cut(s) 117
AflII CTTAAG 1 cut(s) 194
AgsI TTSAA 1 cut(s) 206
AjnI CCWGG 1 cut(s) 141
AjuI GAANNNNNNNTTGG 2 cut(s) 129, 161
AloI GAACNNNNNNTCC 2 cut(s) 123, 155
AluBI AGCT 2 cut(s) 128, 246
AluI AGCT 2 cut(s) 128, 246
AlwI GGATC 1 cut(s) 163
AoxI GGCC 1 cut(s) 87
AsuHPI GGTGA 1 cut(s) 176
BalI TGGCCA 1 cut(s) 89
BauI CACGAG 1 cut(s) 159
BbvCI CCTCAGC 1 cut(s) 33
BccI CCATC 2 cut(s) 182, 227
BciT130I CCWGG 1 cut(s) 143
BfrI CTTAAG 1 cut(s) 194
Bme1390I CCNGG 1 cut(s) 143
BmrFI CCNGG 1 cut(s) 143
Bpu10I CCTNAGC 1 cut(s) 33
BseBI CCWGG 1 cut(s) 143
BseGI GGATG 1 cut(s) 43
BseMII CTCAG 1 cut(s) 24
BshFI GGCC 1 cut(s) 89
BsnI GGCC 1 cut(s) 89
Bsp143I GATC 1 cut(s) 155
BspANI GGCC 1 cut(s) 89
BspCNI CTCAG 1 cut(s) 25
BspHI TCATGA 1 cut(s) 42
BspPI GGATC 1 cut(s) 163
BspTI CTTAAG 1 cut(s) 194
BssMI GATC 1 cut(s) 155
BssSI CACGAG 1 cut(s) 159
Bst2BI CACGAG 1 cut(s) 159
Bst2UI CCWGG 1 cut(s) 143
Bst4CI ACNGT 1 cut(s) 20
BstAFI CTTAAG 1 cut(s) 194
BstDEI CTNAG 1 cut(s) 33
BstF5I GGATG 1 cut(s) 43
BstKTI GATC 1 cut(s) 158
BstMBI GATC 1 cut(s) 155
BstNI CCWGG 1 cut(s) 143
BstSCI CCNGG 1 cut(s) 141
BstX2I RGATCY 1 cut(s) 155
BstYI RGATCY 1 cut(s) 155
BsuRI GGCC 1 cut(s) 89
BtsCI GGATG 1 cut(s) 43
CciI TCATGA 1 cut(s) 42
CviAII CATG 2 cut(s) 43, 85
CviJI RGCY 3 cut(s) 89, 128, 246
CviKI_1 RGCY 3 cut(s) 89, 128, 246
DdeI CTNAG 1 cut(s) 33
DpnI GATC 1 cut(s) 157
DpnII GATC 1 cut(s) 155
EaeI YGGCCR 1 cut(s) 87
Eco57I CTGAAG 1 cut(s) 117
EcoRII CCWGG 1 cut(s) 141
EcoT22I ATGCAT 1 cut(s) 86
FaeI CATG 2 cut(s) 46, 88
FaiI YATR 3 cut(s) 44, 86, 225
FalI AAGNNNNNCTT 2 cut(s) 105, 137
FatI CATG 2 cut(s) 42, 84
FokI GGATG 1 cut(s) 50
HaeIII GGCC 1 cut(s) 89
Hin1II CATG 2 cut(s) 46, 88
HphI GGTGA 1 cut(s) 176
Hpy188III TCNNGA 2 cut(s) 43, 95
HpyCH4III ACNGT 1 cut(s) 20
HpyCH4V TGCA 1 cut(s) 84
HpyF3I CTNAG 1 cut(s) 33
Hsp92II CATG 2 cut(s) 46, 88
Kzo9I GATC 1 cut(s) 155
LpnPI CCDG 4 cut(s) 83, 108, 128, 155
MaeIII GTNAC 2 cut(s) 14, 169
MalI GATC 1 cut(s) 157
MboI GATC 1 cut(s) 155
MboII GAAGA 1 cut(s) 110
MflI RGATCY 1 cut(s) 155
MlsI TGGCCA 1 cut(s) 89
MluNI TGGCCA 1 cut(s) 89
MnlI CCTC 3 cut(s) 28, 146, 206
Mox20I TGGCCA 1 cut(s) 89
Mph1103I ATGCAT 1 cut(s) 86
MscI TGGCCA 1 cut(s) 89
MseI TTAA 2 cut(s) 123, 195
Msp20I TGGCCA 1 cut(s) 89
MspCI CTTAAG 1 cut(s) 194
MspR9I CCNGG 1 cut(s) 143
MvaI CCWGG 1 cut(s) 143
NdeII GATC 1 cut(s) 155
NlaIII CATG 2 cut(s) 46, 88
NsiI ATGCAT 1 cut(s) 86
PagI TCATGA 1 cut(s) 42
PcsI WCGNNNNNNNCGW 1 cut(s) 157
Psp6I CCWGG 1 cut(s) 141
PspGI CCWGG 1 cut(s) 141
PsuI RGATCY 1 cut(s) 155
SaqAI TTAA 2 cut(s) 123, 195
Sau3AI GATC 1 cut(s) 155
ScrFI CCNGG 1 cut(s) 143
SetI ASST 3 cut(s) 130, 147, 248
SmlI CTYRAG 1 cut(s) 194
SmoI CTYRAG 1 cut(s) 194
StyD4I CCNGG 1 cut(s) 141
TaaI ACNGT 1 cut(s) 20
TaqI TCGA 2 cut(s) 151, 211
Tru1I TTAA 2 cut(s) 123, 195
Tru9I TTAA 2 cut(s) 123, 195
TspDTI ATGAA 2 cut(s) 17, 59
Vha464I CTTAAG 1 cut(s) 194
Zsp2I ATGCAT 1 cut(s) 86
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.