RchiOBHm_Chr5g0024931

G-type lectin S-receptor-like serine threonine-protein kinase

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Forward (+)
18962954 .. 18963378
425 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 363 bp
ATGGATATGACAGAGATGGAGGGTCCCAGATTTGGGACCAGCAGCCAACTAAGTGCTGGCGTTTTGGTGATGTATTTGAGCAAGACAATGGTTACTTTAATCCAACAGATTCTAGTGGCTCTAATGCAACATCAACAAGTGATTCAAATAGAAGTCGCAGCATTAGTGATTGTAAGGCTGCTTGTTGGGCAGATTGTGACCGTCTTGGATTCATTTTTCTGCTTGCTACCTAATCGGACTGGATGTCGATTTTGGAATGGAAAGTTAAAGTTCATTCCAGCAAAAGTTGGTTACGGTTCTAGTGTTGTTTATTTTTTAACAACAAAATCAGCCAGCAGGAGCTGGAAGCATTCTTGCTCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

120

Amino Acids

13.35

Weight (kDa)

9.6

Isoelectric Point (pI)

28.07

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0030177)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr5g0024931
rosa_samantha Rh5CG192100

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfiI CCNNNNNNNGG 2 cut(s) 32, 33
AgsI TTSAA 1 cut(s) 146
AhdI GACNNNNNGTC 1 cut(s) 243
AluBI AGCT 1 cut(s) 342
AluI AGCT 1 cut(s) 342
AlwNI CAGNNNCTG 1 cut(s) 342
ApeKI GCWGC 3 cut(s) 42, 158, 178
AspS9I GGNCC 2 cut(s) 23, 36
AsuHPI GGTGA 1 cut(s) 79
AvaII GGWCC 2 cut(s) 23, 36
BbvI GCAGC 3 cut(s) 54, 165, 170
BccI CCATC 1 cut(s) 10
BfaI CTAG 2 cut(s) 113, 300
BisI GCNGC 3 cut(s) 43, 159, 179
BlsI GCNGC 3 cut(s) 44, 160, 180
Bme18I GGWCC 2 cut(s) 23, 36
BmeRI GACNNNNNGTC 1 cut(s) 243
BmgT120I GGNCC 2 cut(s) 23, 36
BmiI GGNNCC 3 cut(s) 24, 25, 37
Bsc4I CCNNNNNNNGG 2 cut(s) 32, 33
Bse1I ACTGG 1 cut(s) 244
BseGI GGATG 1 cut(s) 248
BseLI CCNNNNNNNGG 2 cut(s) 32, 33
BseNI ACTGG 1 cut(s) 244
BseXI GCAGC 3 cut(s) 54, 165, 170
BslFI GGGAC 2 cut(s) 9, 49
BslI CCNNNNNNNGG 2 cut(s) 32, 33
BsmFI GGGAC 2 cut(s) 9, 49
BsmI GAATGC 1 cut(s) 349
BspLI GGNNCC 3 cut(s) 24, 25, 37
BsrI ACTGG 1 cut(s) 244
Bst4CI ACNGT 2 cut(s) 202, 296
BstC8I GCNNGC 3 cut(s) 58, 224, 334
BstDEI CTNAG 1 cut(s) 50
BstF5I GGATG 1 cut(s) 248
BstMWI GCNNNNNNNGC 1 cut(s) 187
BstV1I GCAGC 3 cut(s) 54, 165, 170
BtsCI GGATG 1 cut(s) 248
Cac8I GCNNGC 3 cut(s) 58, 224, 334
CaiI CAGNNNCTG 1 cut(s) 342
Cfr13I GGNCC 2 cut(s) 23, 36
CviJI RGCY 5 cut(s) 45, 119, 178, 332, 342
CviKI_1 RGCY 5 cut(s) 45, 119, 178, 332, 342
DdeI CTNAG 1 cut(s) 50
DriI GACNNNNNGTC 1 cut(s) 243
Eam1105I GACNNNNNGTC 1 cut(s) 243
Eco47I GGWCC 2 cut(s) 23, 36
EcoO109I RGGNCCY 1 cut(s) 23
FaiI YATR 1 cut(s) 8
FaqI GGGAC 2 cut(s) 9, 49
Fnu4HI GCNGC 3 cut(s) 43, 159, 179
FokI GGATG 1 cut(s) 255
Fsp4HI GCNGC 3 cut(s) 43, 159, 179
FspBI CTAG 2 cut(s) 113, 300
GluI GCNGC 3 cut(s) 43, 159, 179
HinfI GANTC 3 cut(s) 109, 142, 209
HphI GGTGA 1 cut(s) 79
Hpy188I TCNGA 1 cut(s) 237
Hpy188III TCNNGA 1 cut(s) 360
HpyCH4III ACNGT 2 cut(s) 202, 296
HpyCH4V TGCA 1 cut(s) 127
HpyF10VI GCNNNNNNNGC 1 cut(s) 187
HpyF3I CTNAG 1 cut(s) 50
KflI GGGWCCC 1 cut(s) 23
LmnI GCTCC 1 cut(s) 339
LpnPI CCDG 8 cut(s) 40, 42, 52, 225, 291, 322, 328, 346
Lsp1109I GCAGC 3 cut(s) 54, 165, 170
MaeI CTAG 2 cut(s) 113, 300
MaeIII GTNAC 3 cut(s) 91, 196, 290
MmeI TCCRAC 1 cut(s) 127
MnlI CCTC 1 cut(s) 13
MseI TTAA 3 cut(s) 98, 266, 317
Mva1269I GAATGC 1 cut(s) 349
MwoI GCNNNNNNNGC 1 cut(s) 187
NlaIV GGNNCC 3 cut(s) 24, 25, 37
NmuCI GTSAC 1 cut(s) 196
PctI GAATGC 1 cut(s) 349
PfeI GAWTC 3 cut(s) 109, 142, 209
PkrI GCNGC 3 cut(s) 44, 160, 180
PpuMI RGGWCCY 1 cut(s) 23
Psp5II RGGWCCY 1 cut(s) 23
PspN4I GGNNCC 3 cut(s) 24, 25, 37
PspPI GGNCC 2 cut(s) 23, 36
PspPPI RGGWCCY 1 cut(s) 23
PstNI CAGNNNCTG 1 cut(s) 342
SaqAI TTAA 3 cut(s) 98, 266, 317
SatI GCNGC 3 cut(s) 43, 159, 179
Sau96I GGNCC 2 cut(s) 23, 36
SetI ASST 2 cut(s) 232, 344
SinI GGWCC 2 cut(s) 23, 36
SspMI CTAG 2 cut(s) 113, 300
TaaI ACNGT 2 cut(s) 202, 296
TaqI TCGA 1 cut(s) 247
TfiI GAWTC 3 cut(s) 109, 142, 209
Tru1I TTAA 3 cut(s) 98, 266, 317
Tru9I TTAA 3 cut(s) 98, 266, 317
TseFI GTSAC 1 cut(s) 196
TseI GCWGC 3 cut(s) 42, 158, 178
Tsp45I GTSAC 1 cut(s) 196
TspDTI ATGAA 2 cut(s) 201, 262
VpaK11BI GGWCC 2 cut(s) 23, 36
XcmI CCANNNNNNNNNTGG 1 cut(s) 53
XspI CTAG 2 cut(s) 113, 300
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.