Rh5CG192100

G-type lectin S-receptor-like serine threonine-protein kinase

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5C
Physical Location & Seq
Forward (+)
19135068 .. 19135415
348 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5CG192100.1

Sequence Viewer

Length: 348 bp
ATGGAGGGTCCCAGATTTGGGACCAGCAGCCAACTAAGTGCTGGCGTTTTGGTGATGTATTTGAGCAAGACAATGGTTACTTTAATCCAACAGATTCTAGTGGCTCTAATGCAACATCAACAAGTGATTCAAATAGAAGTCGCAGCATTAGTGATTGTAAGGCTGCTTGTTGGGCAGATTGTGACCGTCTTGGATTCATTTTTCTGCTTGCTACCTAATCGGACTGGATGTCGATTTTGGAATGGAAAGTTAAAGTTCATTCCAGCAAAAGTTGGTTACGGTTCTAGTGTTGTTTATTTTTTAACAACAAAATCAGCCAGCAGGAGCTGGAAGCATTCTTGCTCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

115

Amino Acids

12.74

Weight (kDa)

9.95

Isoelectric Point (pI)

27.43

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0030177)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr5g0024931
rosa_samantha Rh5CG192100

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfiI CCNNNNNNNGG 2 cut(s) 17, 18
AgsI TTSAA 1 cut(s) 131
AhdI GACNNNNNGTC 1 cut(s) 228
AluBI AGCT 1 cut(s) 327
AluI AGCT 1 cut(s) 327
AlwNI CAGNNNCTG 1 cut(s) 327
ApeKI GCWGC 3 cut(s) 27, 143, 163
AspS9I GGNCC 2 cut(s) 8, 21
AsuHPI GGTGA 1 cut(s) 64
AvaII GGWCC 2 cut(s) 8, 21
BbvI GCAGC 3 cut(s) 39, 150, 155
BfaI CTAG 2 cut(s) 98, 285
BisI GCNGC 3 cut(s) 28, 144, 164
BlsI GCNGC 3 cut(s) 29, 145, 165
Bme18I GGWCC 2 cut(s) 8, 21
BmeRI GACNNNNNGTC 1 cut(s) 228
BmgT120I GGNCC 2 cut(s) 8, 21
BmiI GGNNCC 3 cut(s) 9, 10, 22
Bsc4I CCNNNNNNNGG 2 cut(s) 17, 18
Bse1I ACTGG 1 cut(s) 229
BseGI GGATG 1 cut(s) 233
BseLI CCNNNNNNNGG 2 cut(s) 17, 18
BseNI ACTGG 1 cut(s) 229
BseXI GCAGC 3 cut(s) 39, 150, 155
BslFI GGGAC 1 cut(s) 34
BslI CCNNNNNNNGG 2 cut(s) 17, 18
BsmFI GGGAC 1 cut(s) 34
BsmI GAATGC 1 cut(s) 334
BspLI GGNNCC 3 cut(s) 9, 10, 22
BsrI ACTGG 1 cut(s) 229
Bst4CI ACNGT 2 cut(s) 187, 281
BstC8I GCNNGC 3 cut(s) 43, 209, 319
BstDEI CTNAG 1 cut(s) 35
BstF5I GGATG 1 cut(s) 233
BstMWI GCNNNNNNNGC 1 cut(s) 172
BstV1I GCAGC 3 cut(s) 39, 150, 155
BtsCI GGATG 1 cut(s) 233
Cac8I GCNNGC 3 cut(s) 43, 209, 319
CaiI CAGNNNCTG 1 cut(s) 327
Cfr13I GGNCC 2 cut(s) 8, 21
CviJI RGCY 5 cut(s) 30, 104, 163, 317, 327
CviKI_1 RGCY 5 cut(s) 30, 104, 163, 317, 327
DdeI CTNAG 1 cut(s) 35
DriI GACNNNNNGTC 1 cut(s) 228
Eam1105I GACNNNNNGTC 1 cut(s) 228
Eco47I GGWCC 2 cut(s) 8, 21
EcoO109I RGGNCCY 1 cut(s) 8
FaqI GGGAC 1 cut(s) 34
Fnu4HI GCNGC 3 cut(s) 28, 144, 164
FokI GGATG 1 cut(s) 240
Fsp4HI GCNGC 3 cut(s) 28, 144, 164
FspBI CTAG 2 cut(s) 98, 285
GluI GCNGC 3 cut(s) 28, 144, 164
HinfI GANTC 3 cut(s) 94, 127, 194
HphI GGTGA 1 cut(s) 64
Hpy188I TCNGA 1 cut(s) 222
Hpy188III TCNNGA 1 cut(s) 345
HpyCH4III ACNGT 2 cut(s) 187, 281
HpyCH4V TGCA 1 cut(s) 112
HpyF10VI GCNNNNNNNGC 1 cut(s) 172
HpyF3I CTNAG 1 cut(s) 35
KflI GGGWCCC 1 cut(s) 8
LmnI GCTCC 1 cut(s) 324
LpnPI CCDG 8 cut(s) 25, 27, 37, 210, 276, 307, 313, 331
Lsp1109I GCAGC 3 cut(s) 39, 150, 155
MaeI CTAG 2 cut(s) 98, 285
MaeIII GTNAC 3 cut(s) 76, 181, 275
MmeI TCCRAC 1 cut(s) 112
MseI TTAA 3 cut(s) 83, 251, 302
Mva1269I GAATGC 1 cut(s) 334
MwoI GCNNNNNNNGC 1 cut(s) 172
NlaIV GGNNCC 3 cut(s) 9, 10, 22
NmuCI GTSAC 1 cut(s) 181
PctI GAATGC 1 cut(s) 334
PfeI GAWTC 3 cut(s) 94, 127, 194
PkrI GCNGC 3 cut(s) 29, 145, 165
PpuMI RGGWCCY 1 cut(s) 8
Psp5II RGGWCCY 1 cut(s) 8
PspN4I GGNNCC 3 cut(s) 9, 10, 22
PspPI GGNCC 2 cut(s) 8, 21
PspPPI RGGWCCY 1 cut(s) 8
PstNI CAGNNNCTG 1 cut(s) 327
SaqAI TTAA 3 cut(s) 83, 251, 302
SatI GCNGC 3 cut(s) 28, 144, 164
Sau96I GGNCC 2 cut(s) 8, 21
SetI ASST 2 cut(s) 217, 329
SinI GGWCC 2 cut(s) 8, 21
SspMI CTAG 2 cut(s) 98, 285
TaaI ACNGT 2 cut(s) 187, 281
TaqI TCGA 1 cut(s) 232
TfiI GAWTC 3 cut(s) 94, 127, 194
Tru1I TTAA 3 cut(s) 83, 251, 302
Tru9I TTAA 3 cut(s) 83, 251, 302
TseFI GTSAC 1 cut(s) 181
TseI GCWGC 3 cut(s) 27, 143, 163
Tsp45I GTSAC 1 cut(s) 181
TspDTI ATGAA 2 cut(s) 186, 247
VpaK11BI GGWCC 2 cut(s) 8, 21
XcmI CCANNNNNNNNNTGG 1 cut(s) 38
XspI CTAG 2 cut(s) 98, 285
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.