RchiOBHm_Chr5g0032561

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Reverse (-)
26319863 .. 26322828
2966 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 138 bp
ATGAGTTTGAGCAATGGAATGAGAACCTGTGCCAAGGTCTTGATGTGTTCAGAAGCACCGTTATCAAAAATCAGGTATTCATTTGGATTCCTTGTCAATATTCAAGATTTCAGGACTTCGCGAAAAATATTATCATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

45

Amino Acids

5.1

Weight (kDa)

10.05

Isoelectric Point (pI)

36.68

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0030128)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr5g0032561
rosa_samantha Rh7BG465200

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 121
AgsI TTSAA 1 cut(s) 104
BsaJI CCNNGG 1 cut(s) 33
Bse3DI GCAATG 1 cut(s) 19
BseDI CCNNGG 1 cut(s) 33
BseMI GCAATG 1 cut(s) 19
Bsh1236I CGCG 1 cut(s) 121
Bsp68I TCGCGA 1 cut(s) 121
BspFNI CGCG 1 cut(s) 121
BsrDI GCAATG 1 cut(s) 19
BssECI CCNNGG 1 cut(s) 33
BssT1I CCWWGG 1 cut(s) 33
Bst4CI ACNGT 1 cut(s) 60
BstFNI CGCG 1 cut(s) 121
BstUI CGCG 1 cut(s) 121
BtuMI TCGCGA 1 cut(s) 121
Eco130I CCWWGG 1 cut(s) 33
EcoT14I CCWWGG 1 cut(s) 33
ErhI CCWWGG 1 cut(s) 33
FaiI YATR 1 cut(s) 136
FspEI CC 8 cut(s) 20, 40, 46, 58, 69, 72, 97, 104
HinfI GANTC 1 cut(s) 87
Hpy188I TCNGA 1 cut(s) 52
Hpy188III TCNNGA 4 cut(s) 40, 104, 112, 120
HpyCH4III ACNGT 1 cut(s) 60
LpnPI CCDG 3 cut(s) 40, 58, 97
MvnI CGCG 1 cut(s) 121
NruI TCGCGA 1 cut(s) 121
PfeI GAWTC 1 cut(s) 87
RruI TCGCGA 1 cut(s) 121
SetI ASST 3 cut(s) 29, 39, 77
SgeI CNNG 8 cut(s) 39, 46, 52, 85, 104, 116, 124, 132
SspI AATATT 2 cut(s) 100, 129
StyI CCWWGG 1 cut(s) 33
TaaI ACNGT 1 cut(s) 60
TfiI GAWTC 1 cut(s) 87
TspDTI ATGAA 1 cut(s) 69
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.