Rh7BG465200

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7B
Physical Location & Seq
Reverse (-)
55093862 .. 55095347
1486 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7BG465200.1

Sequence Viewer

Length: 189 bp
ATGAGTTTGAGCAGTGGGATGAGGACCTGTGCCAAGGTCTTGATGTCTTCAGAAGCATCGCTGTCGAAATCAGTAATGGAATGGTTTCATTATCTAAATGAAGAACATTTTGCACCAGAGAATCAGTTCTTCGGTCATTTACCCTTTGACAGTATACACATTCTCCAATCTGACCTAGCTGTTGAGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

62

Amino Acids

7.06

Weight (kDa)

5.12

Isoelectric Point (pI)

77.1

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0030128)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr5g0032561
rosa_samantha Rh7BG465200

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 154
AcuI CTGAAG 1 cut(s) 33
AluBI AGCT 1 cut(s) 179
AluI AGCT 1 cut(s) 179
Asp700I GAANNNNTTC 2 cut(s) 84, 125
AspS9I GGNCC 1 cut(s) 24
AvaII GGWCC 1 cut(s) 24
BbsI GAAGAC 1 cut(s) 39
BcgI CGANNNNNNTGC 2 cut(s) 45, 79
BfaI CTAG 1 cut(s) 176
Bme18I GGWCC 1 cut(s) 24
BmgT120I GGNCC 1 cut(s) 24
BmsI GCATC 1 cut(s) 65
BpiI GAAGAC 1 cut(s) 39
BsaJI CCNNGG 1 cut(s) 33
BsaXI ACNNNNNCTCC 2 cut(s) 147, 177
BseDI CCNNGG 1 cut(s) 33
BseGI GGATG 1 cut(s) 24
BssECI CCNNGG 1 cut(s) 33
BssNAI GTATAC 1 cut(s) 155
BssT1I CCWWGG 1 cut(s) 33
Bst1107I GTATAC 1 cut(s) 155
Bst4CI ACNGT 1 cut(s) 152
BstF5I GGATG 1 cut(s) 24
BstV2I GAAGAC 1 cut(s) 39
BstZ17I GTATAC 1 cut(s) 155
BtgZI GCGATG 1 cut(s) 42
BtsCI GGATG 1 cut(s) 24
BtsI GCAGTG 1 cut(s) 19
BtsIMutI CAGTG 1 cut(s) 19
Cfr13I GGNCC 1 cut(s) 24
CviJI RGCY 1 cut(s) 179
CviKI_1 RGCY 1 cut(s) 179
Eco130I CCWWGG 1 cut(s) 33
Eco47I GGWCC 1 cut(s) 24
Eco57I CTGAAG 1 cut(s) 33
EcoO109I RGGNCCY 1 cut(s) 24
EcoT14I CCWWGG 1 cut(s) 33
ErhI CCWWGG 1 cut(s) 33
FaiI YATR 1 cut(s) 155
FblI GTMKAC 1 cut(s) 154
FokI GGATG 1 cut(s) 31
FspBI CTAG 1 cut(s) 176
HinfI GANTC 1 cut(s) 121
Hpy166II GTNNAC 1 cut(s) 155
Hpy188I TCNGA 2 cut(s) 52, 172
Hpy188III TCNNGA 1 cut(s) 40
Hpy8I GTNNAC 1 cut(s) 155
HpyCH4III ACNGT 1 cut(s) 152
HpyCH4V TGCA 1 cut(s) 113
LpnPI CCDG 2 cut(s) 40, 129
LweI GCATC 1 cut(s) 65
MaeI CTAG 1 cut(s) 176
MboII GAAGA 3 cut(s) 39, 113, 121
MnlI CCTC 1 cut(s) 15
MroXI GAANNNNTTC 2 cut(s) 84, 125
PdmI GAANNNNTTC 2 cut(s) 84, 125
PfeI GAWTC 1 cut(s) 121
PpuMI RGGWCCY 1 cut(s) 24
Psp5II RGGWCCY 1 cut(s) 24
PspPI GGNCC 1 cut(s) 24
PspPPI RGGWCCY 1 cut(s) 24
Sau96I GGNCC 1 cut(s) 24
SetI ASST 4 cut(s) 29, 39, 177, 181
SfaNI GCATC 1 cut(s) 65
SgeI CNNG 4 cut(s) 39, 46, 52, 128
SinI GGWCC 1 cut(s) 24
SspMI CTAG 1 cut(s) 176
StyI CCWWGG 1 cut(s) 33
TaaI ACNGT 1 cut(s) 152
TaqI TCGA 1 cut(s) 65
TaqII GACCGA 1 cut(s) 122
TfiI GAWTC 1 cut(s) 121
TscAI CASTG 1 cut(s) 19
TspDTI ATGAA 2 cut(s) 77, 114
TspRI CASTG 1 cut(s) 19
VpaK11BI GGWCC 1 cut(s) 24
XmiI GTMKAC 1 cut(s) 154
XmnI GAANNNNTTC 2 cut(s) 84, 125
XspI CTAG 1 cut(s) 176
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.