RchiOBHm_Chr5g0046071

Haloacid dehalogenase-like hydrolase

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Forward (+)
42138057 .. 42140566
2510 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 177 bp
ATGGGACGAGAGCGATTCGATTCCCTCCAAACGGCTGGCCATCCCTGGTTTTCCATTCTGACAAGGACTGGAGTTTTCAAGGGAAAGGAAAATCATGACGAGTTTCCAGCTGATCTGGTTGTTGATACTGTCGAAGAAGCAGTGGACTATGTTTTGAAAAAGGAGTTGATCTCTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

58

Amino Acids

6.62

Weight (kDa)

4.92

Isoelectric Point (pI)

17.8

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0019930)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr5g0046071
rosa_roxburghii Rroxscaffold_5G00349070
rosa_rugosa Rorug06G0047900
rosa_samantha Rh5BG315100 Rh5DG325300
rosa_wichuraiana Rw2G027100 Rw7G025000

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 37
AfiI CCNNNNNNNGG 1 cut(s) 31
AgsI TTSAA 2 cut(s) 79, 157
AjnI CCWGG 1 cut(s) 44
AluBI AGCT 1 cut(s) 110
AluI AGCT 1 cut(s) 110
AoxI GGCC 1 cut(s) 37
BalI TGGCCA 1 cut(s) 39
BccI CCATC 1 cut(s) 48
BceAI ACGGC 1 cut(s) 48
BciT130I CCWGG 1 cut(s) 46
Bme1390I CCNGG 1 cut(s) 46
BmrFI CCNGG 1 cut(s) 46
BplI GAGNNNNNCTC 1 cut(s) 155
BpmI CTGGAG 1 cut(s) 90
BsaJI CCNNGG 1 cut(s) 44
Bsc4I CCNNNNNNNGG 1 cut(s) 31
Bse1I ACTGG 1 cut(s) 73
BseBI CCWGG 1 cut(s) 46
BseDI CCNNGG 1 cut(s) 44
BseGI GGATG 1 cut(s) 40
BseLI CCNNNNNNNGG 1 cut(s) 31
BseNI ACTGG 1 cut(s) 73
BshFI GGCC 1 cut(s) 39
BslFI GGGAC 1 cut(s) 18
BslI CCNNNNNNNGG 1 cut(s) 31
BsmFI GGGAC 1 cut(s) 18
BsnI GGCC 1 cut(s) 39
Bsp143I GATC 2 cut(s) 112, 168
BspANI GGCC 1 cut(s) 39
BspHI TCATGA 1 cut(s) 94
BsrI ACTGG 1 cut(s) 73
BssECI CCNNGG 1 cut(s) 44
BssMI GATC 2 cut(s) 112, 168
Bst2UI CCWGG 1 cut(s) 46
Bst4CI ACNGT 1 cut(s) 130
BstC8I GCNNGC 1 cut(s) 37
BstDEI CTNAG 1 cut(s) 174
BstF5I GGATG 1 cut(s) 40
BstKTI GATC 2 cut(s) 115, 171
BstMBI GATC 2 cut(s) 112, 168
BstNI CCWGG 1 cut(s) 46
BstSCI CCNGG 1 cut(s) 44
BstXI CCANNNNNNTGG 1 cut(s) 35
BsuRI GGCC 1 cut(s) 39
BtsCI GGATG 1 cut(s) 40
BtsI GCAGTG 1 cut(s) 147
BtsIMutI CAGTG 1 cut(s) 147
Cac8I GCNNGC 1 cut(s) 37
CciI TCATGA 1 cut(s) 94
CviAII CATG 1 cut(s) 95
CviJI RGCY 3 cut(s) 35, 39, 110
CviKI_1 RGCY 3 cut(s) 35, 39, 110
DdeI CTNAG 1 cut(s) 174
DpnI GATC 2 cut(s) 114, 170
DpnII GATC 2 cut(s) 112, 168
EaeI YGGCCR 1 cut(s) 37
EcoRII CCWGG 1 cut(s) 44
FaeI CATG 1 cut(s) 98
FaiI YATR 2 cut(s) 96, 150
FaqI GGGAC 1 cut(s) 18
FatI CATG 1 cut(s) 94
FokI GGATG 1 cut(s) 27
GsuI CTGGAG 1 cut(s) 90
HaeIII GGCC 1 cut(s) 39
Hin1II CATG 1 cut(s) 98
HinfI GANTC 2 cut(s) 15, 20
Hpy166II GTNNAC 1 cut(s) 145
Hpy188I TCNGA 1 cut(s) 60
Hpy188III TCNNGA 1 cut(s) 95
Hpy8I GTNNAC 1 cut(s) 145
HpyCH4III ACNGT 1 cut(s) 130
HpyF3I CTNAG 1 cut(s) 174
Hsp92II CATG 1 cut(s) 98
Kzo9I GATC 2 cut(s) 112, 168
LpnPI CCDG 6 cut(s) 21, 31, 54, 58, 101, 120
MalI GATC 2 cut(s) 114, 170
MboI GATC 2 cut(s) 112, 168
MboII GAAGA 1 cut(s) 146
MlsI TGGCCA 1 cut(s) 39
MluNI TGGCCA 1 cut(s) 39
MnlI CCTC 1 cut(s) 35
Mox20I TGGCCA 1 cut(s) 39
MscI TGGCCA 1 cut(s) 39
Msp20I TGGCCA 1 cut(s) 39
MspA1I CMGCKG 1 cut(s) 110
MspR9I CCNGG 1 cut(s) 46
MvaI CCWGG 1 cut(s) 46
NdeII GATC 2 cut(s) 112, 168
NlaIII CATG 1 cut(s) 98
PagI TCATGA 1 cut(s) 94
PfeI GAWTC 2 cut(s) 15, 20
Psp6I CCWGG 1 cut(s) 44
PspGI CCWGG 1 cut(s) 44
PvuII CAGCTG 1 cut(s) 110
Sau3AI GATC 2 cut(s) 112, 168
ScrFI CCNGG 1 cut(s) 46
SetI ASST 1 cut(s) 112
StyD4I CCNGG 1 cut(s) 44
TaaI ACNGT 1 cut(s) 130
TaqI TCGA 2 cut(s) 18, 132
TfiI GAWTC 2 cut(s) 15, 20
TscAI CASTG 1 cut(s) 147
TspRI CASTG 1 cut(s) 147
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.