RchiOBHm_Chr4g0390121

Phosphatidylinositol phosphatidylcholine transfer protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
Physical Location & Seq
Forward (+)
5312193 .. 5314259
2067 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 219 bp
ATGGTGTTCGATATGGTGATTGGTGGTTGTTTGGCTTTCAATGAGACAAGGATAACGGCTCCACCAACAACGCGGTTATGGATTGGATTCATGGCTCGAGTTACTGAACTGATTTTAGCAACTTTCTATTTAAATAGTCAACTTTCTGACTTCCTTGGGGGAGATTGCTCATGTCCAAATGAAGGCGGGTGCTTAGGTCTGCAAGGGACCCTGGAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

72

Amino Acids

7.78

Weight (kDa)

4.34

Isoelectric Point (pI)

55.01

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0029780)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr2g0143731 RchiOBHm_Chr4g0390121

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 73
AciI CCGC 2 cut(s) 73, 186
AfiI CCNNNNNNNGG 1 cut(s) 182
AgsI TTSAA 1 cut(s) 40
AjnI CCWGG 1 cut(s) 210
Alw26I GTCTC 1 cut(s) 38
Ama87I CYCGRG 1 cut(s) 96
AspS9I GGNCC 1 cut(s) 207
AsuHPI GGTGA 1 cut(s) 28
AvaI CYCGRG 1 cut(s) 96
AvaII GGWCC 1 cut(s) 207
BceAI ACGGC 1 cut(s) 72
BciT130I CCWGG 1 cut(s) 212
BcoDI GTCTC 1 cut(s) 38
Bme1390I CCNGG 1 cut(s) 212
Bme18I GGWCC 1 cut(s) 207
BmeT110I CYCGRG 1 cut(s) 96
BmgT120I GGNCC 1 cut(s) 207
BmiI GGNNCC 3 cut(s) 60, 208, 209
BmrFI CCNGG 1 cut(s) 212
Bpu10I CCTNAGC 1 cut(s) 193
BsaJI CCNNGG 2 cut(s) 154, 210
Bsc4I CCNNNNNNNGG 1 cut(s) 182
BseBI CCWGG 1 cut(s) 212
BseDI CCNNGG 2 cut(s) 154, 210
BseLI CCNNNNNNNGG 1 cut(s) 182
Bsh1236I CGCG 1 cut(s) 73
BsiHKCI CYCGRG 1 cut(s) 96
BslI CCNNNNNNNGG 1 cut(s) 182
BsmAI GTCTC 1 cut(s) 38
BsoBI CYCGRG 1 cut(s) 96
BspACI CCGC 2 cut(s) 73, 186
BspFNI CGCG 1 cut(s) 73
BspLI GGNNCC 3 cut(s) 60, 208, 209
BssECI CCNNGG 2 cut(s) 154, 210
BssT1I CCWWGG 1 cut(s) 154
Bst2UI CCWGG 1 cut(s) 212
BstDEI CTNAG 1 cut(s) 193
BstFNI CGCG 1 cut(s) 73
BstMAI GTCTC 1 cut(s) 38
BstNI CCWGG 1 cut(s) 212
BstSCI CCNGG 1 cut(s) 210
BstUI CGCG 1 cut(s) 73
Cfr13I GGNCC 1 cut(s) 207
CviAII CATG 2 cut(s) 91, 171
CviJI RGCY 3 cut(s) 35, 59, 95
CviKI_1 RGCY 3 cut(s) 35, 59, 95
DdeI CTNAG 1 cut(s) 193
DraI TTTAAA 1 cut(s) 132
Eco130I CCWWGG 1 cut(s) 154
Eco47I GGWCC 1 cut(s) 207
Eco88I CYCGRG 1 cut(s) 96
EcoO109I RGGNCCY 1 cut(s) 207
EcoRII CCWGG 1 cut(s) 210
EcoT14I CCWWGG 1 cut(s) 154
ErhI CCWWGG 1 cut(s) 154
FaeI CATG 2 cut(s) 94, 174
FaiI YATR 4 cut(s) 14, 79, 92, 172
FatI CATG 2 cut(s) 90, 170
FauI CCCGC 1 cut(s) 179
Hin1II CATG 2 cut(s) 94, 174
HincII GTYRAC 1 cut(s) 140
HindII GTYRAC 1 cut(s) 140
HinfI GANTC 1 cut(s) 87
HphI GGTGA 1 cut(s) 28
Hpy166II GTNNAC 1 cut(s) 140
Hpy188I TCNGA 1 cut(s) 148
Hpy8I GTNNAC 1 cut(s) 140
HpyAV CCTTC 1 cut(s) 176
HpyCH4V TGCA 1 cut(s) 202
HpyF3I CTNAG 1 cut(s) 193
Hsp92II CATG 2 cut(s) 94, 174
KflI GGGWCCC 1 cut(s) 207
LmnI GCTCC 1 cut(s) 64
LpnPI CCDG 1 cut(s) 197
MaeIII GTNAC 1 cut(s) 100
MseI TTAA 1 cut(s) 131
MspR9I CCNGG 1 cut(s) 212
MvaI CCWGG 1 cut(s) 212
MvnI CGCG 1 cut(s) 73
NlaIII CATG 2 cut(s) 94, 174
NlaIV GGNNCC 3 cut(s) 60, 208, 209
PaeR7I CTCGAG 1 cut(s) 96
PfeI GAWTC 1 cut(s) 87
PpuMI RGGWCCY 1 cut(s) 207
Psp5II RGGWCCY 1 cut(s) 207
Psp6I CCWGG 1 cut(s) 210
PspGI CCWGG 1 cut(s) 210
PspN4I GGNNCC 3 cut(s) 60, 208, 209
PspPI GGNCC 1 cut(s) 207
PspPPI RGGWCCY 1 cut(s) 207
PspXI VCTCGAGB 1 cut(s) 96
SaqAI TTAA 1 cut(s) 131
Sau96I GGNCC 1 cut(s) 207
ScrFI CCNGG 1 cut(s) 212
SetI ASST 1 cut(s) 199
Sfr274I CTCGAG 1 cut(s) 96
SgeI CNNG 9 cut(s) 60, 84, 103, 108, 110, 167, 183, 199, 215
SinI GGWCC 1 cut(s) 207
SlaI CTCGAG 1 cut(s) 96
SmiI ATTTAAAT 1 cut(s) 132
SmlI CTYRAG 1 cut(s) 96
SmoI CTYRAG 1 cut(s) 96
SsiI CCGC 2 cut(s) 73, 186
StyD4I CCNGG 1 cut(s) 210
StyI CCWWGG 1 cut(s) 154
SwaI ATTTAAAT 1 cut(s) 132
TaqI TCGA 2 cut(s) 9, 97
TfiI GAWTC 1 cut(s) 87
Tru1I TTAA 1 cut(s) 131
Tru9I TTAA 1 cut(s) 131
TspDTI ATGAA 2 cut(s) 79, 195
VpaK11BI GGWCC 1 cut(s) 207
XhoI CTCGAG 1 cut(s) 96
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.