RchiOBHm_Chr2g0143731

phosphatidylinositol phosphatidylcholine transfer protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Reverse (-)
61385666 .. 61385934
269 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ51381

Sequence Viewer

Length: 228 bp
ATGGTGTTCGATATGGTGATTGGTGGTTGTTTGGCTTTCAATGAGAGTTGGAGTACAAGGATAACAGCTCCACCAACAACGCGGTTATGGATTGGATTCATGGCTCGAGTTACTGAACTGATTTTAGCAACTTTCTATTTAAACAGTCAACTTCCTAACTTCCTTGGGGGAGATTGCTCATGTCCAAATGAAGGCGGGTGCTTAGGTCTGCAAGGGACCCTGGAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

75

Amino Acids

8.15

Weight (kDa)

4.51

Isoelectric Point (pI)

57.35

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0029780)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr2g0143731 RchiOBHm_Chr4g0390121

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 82
AciI CCGC 2 cut(s) 82, 195
AfaI GTAC 1 cut(s) 55
AfiI CCNNNNNNNGG 1 cut(s) 191
AgsI TTSAA 1 cut(s) 40
AjnI CCWGG 1 cut(s) 219
AluBI AGCT 1 cut(s) 68
AluI AGCT 1 cut(s) 68
Ama87I CYCGRG 1 cut(s) 105
AspS9I GGNCC 1 cut(s) 216
AsuHPI GGTGA 1 cut(s) 28
AvaI CYCGRG 1 cut(s) 105
AvaII GGWCC 1 cut(s) 216
BciT130I CCWGG 1 cut(s) 221
Bme1390I CCNGG 1 cut(s) 221
Bme18I GGWCC 1 cut(s) 216
BmeT110I CYCGRG 1 cut(s) 105
BmgT120I GGNCC 1 cut(s) 216
BmiI GGNNCC 2 cut(s) 217, 218
BmrFI CCNGG 1 cut(s) 221
Bpu10I CCTNAGC 1 cut(s) 202
BsaJI CCNNGG 2 cut(s) 163, 219
Bsc4I CCNNNNNNNGG 1 cut(s) 191
BseBI CCWGG 1 cut(s) 221
BseDI CCNNGG 2 cut(s) 163, 219
BseLI CCNNNNNNNGG 1 cut(s) 191
Bsh1236I CGCG 1 cut(s) 82
BsiHKCI CYCGRG 1 cut(s) 105
BslI CCNNNNNNNGG 1 cut(s) 191
BsoBI CYCGRG 1 cut(s) 105
BspACI CCGC 2 cut(s) 82, 195
BspFNI CGCG 1 cut(s) 82
BspLI GGNNCC 2 cut(s) 217, 218
BssECI CCNNGG 2 cut(s) 163, 219
BssT1I CCWWGG 1 cut(s) 163
Bst2UI CCWGG 1 cut(s) 221
Bst4CI ACNGT 1 cut(s) 146
BstDEI CTNAG 1 cut(s) 202
BstFNI CGCG 1 cut(s) 82
BstNI CCWGG 1 cut(s) 221
BstSCI CCNGG 1 cut(s) 219
BstUI CGCG 1 cut(s) 82
Cfr13I GGNCC 1 cut(s) 216
Csp6I GTAC 1 cut(s) 54
CviAII CATG 2 cut(s) 100, 180
CviJI RGCY 3 cut(s) 35, 68, 104
CviKI_1 RGCY 3 cut(s) 35, 68, 104
CviQI GTAC 1 cut(s) 54
DdeI CTNAG 1 cut(s) 202
DraI TTTAAA 1 cut(s) 141
Eco130I CCWWGG 1 cut(s) 163
Eco47I GGWCC 1 cut(s) 216
Eco88I CYCGRG 1 cut(s) 105
EcoO109I RGGNCCY 1 cut(s) 216
EcoRII CCWGG 1 cut(s) 219
EcoT14I CCWWGG 1 cut(s) 163
ErhI CCWWGG 1 cut(s) 163
FaeI CATG 2 cut(s) 103, 183
FaiI YATR 4 cut(s) 14, 88, 101, 181
FatI CATG 2 cut(s) 99, 179
FauI CCCGC 1 cut(s) 188
Hin1II CATG 2 cut(s) 103, 183
HincII GTYRAC 1 cut(s) 149
HindII GTYRAC 1 cut(s) 149
HinfI GANTC 1 cut(s) 96
HphI GGTGA 1 cut(s) 28
Hpy166II GTNNAC 1 cut(s) 149
Hpy8I GTNNAC 1 cut(s) 149
HpyAV CCTTC 1 cut(s) 185
HpyCH4III ACNGT 1 cut(s) 146
HpyCH4V TGCA 1 cut(s) 211
HpyF3I CTNAG 1 cut(s) 202
Hsp92II CATG 2 cut(s) 103, 183
KflI GGGWCCC 1 cut(s) 216
LmnI GCTCC 1 cut(s) 73
LpnPI CCDG 1 cut(s) 206
MaeIII GTNAC 1 cut(s) 109
MmeI TCCRAC 1 cut(s) 29
MseI TTAA 1 cut(s) 140
MspR9I CCNGG 1 cut(s) 221
MvaI CCWGG 1 cut(s) 221
MvnI CGCG 1 cut(s) 82
NlaIII CATG 2 cut(s) 103, 183
NlaIV GGNNCC 2 cut(s) 217, 218
PaeR7I CTCGAG 1 cut(s) 105
PfeI GAWTC 1 cut(s) 96
PpuMI RGGWCCY 1 cut(s) 216
Psp5II RGGWCCY 1 cut(s) 216
Psp6I CCWGG 1 cut(s) 219
PspGI CCWGG 1 cut(s) 219
PspN4I GGNNCC 2 cut(s) 217, 218
PspPI GGNCC 1 cut(s) 216
PspPPI RGGWCCY 1 cut(s) 216
PspXI VCTCGAGB 1 cut(s) 105
RsaI GTAC 1 cut(s) 55
RsaNI GTAC 1 cut(s) 54
SaqAI TTAA 1 cut(s) 140
Sau96I GGNCC 1 cut(s) 216
ScrFI CCNGG 1 cut(s) 221
SetI ASST 2 cut(s) 70, 208
Sfr274I CTCGAG 1 cut(s) 105
SgeI CNNG 9 cut(s) 69, 93, 112, 117, 119, 176, 192, 208, 224
SinI GGWCC 1 cut(s) 216
SlaI CTCGAG 1 cut(s) 105
SmlI CTYRAG 1 cut(s) 105
SmoI CTYRAG 1 cut(s) 105
SsiI CCGC 2 cut(s) 82, 195
StyD4I CCNGG 1 cut(s) 219
StyI CCWWGG 1 cut(s) 163
TaaI ACNGT 1 cut(s) 146
TaqI TCGA 2 cut(s) 9, 106
TatI WGTACW 1 cut(s) 53
TfiI GAWTC 1 cut(s) 96
Tru1I TTAA 1 cut(s) 140
Tru9I TTAA 1 cut(s) 140
TspDTI ATGAA 2 cut(s) 88, 204
VpaK11BI GGWCC 1 cut(s) 216
XhoI CTCGAG 1 cut(s) 105
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.