RchiOBHm_Chr4g0399321

synthase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
OG0024944
Physical Location & Seq
Reverse (-)
16511636 .. 16513317
1682 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 501 bp
ATGGATTGGGTGTTTAATGACCCCAATATTTTAAAGGCTACATCCAGGGGCGGATCTAGGTACAGACTGGGGCGGGCTCAAGCCCGTCCGAGATTTTTGAGCTTCAAAAAAAAATTAGATGTATACTTACAAAGAATTGTATATTGGCATTGTCAAGCCCACTCGAAAGTACCAAGCTTGAAACTGCCGAACTCTCAAACACCATGCCTCATCAGTGGAATGCTACAGGAATCAATACAGCGTCACAGGAAGTCAATGATTCATGCATGGAAAGATATGAACCAAGAGTGGCTCGATCTCCACTCTAATACAACTATTCCCATGCCTCTACTGCTGGTAATTCTGAATCATGCACGTTTGAGTAAACTTCTATACAAGAATGAAGATGTGTTCACTCATCCTAAAACATTGCTCAAGGAGCATCTTCAACTGGACCAGATACCAACTCCATCTGCATCGACCTCCGACCTTGACCATCTCAGAACCAAAAACCTGCAATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00909 map00909
Pfam Domains
Protein Families
Terpene_synth Terpene_synth_C

Protein Analysis

166

Amino Acids

19.39

Weight (kDa)

9.96

Isoelectric Point (pI)

32.27

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0024944)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr4g0399321 RchiOBHm_Chr7g0219461
rosa_samantha Rh4DG086700

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 123
AciI CCGC 2 cut(s) 51, 73
AclWI GGATC 1 cut(s) 61
AfaI GTAC 2 cut(s) 62, 171
AgsI TTSAA 3 cut(s) 106, 181, 428
AjnI CCWGG 1 cut(s) 44
AjuI GAANNNNNNNTTGG 2 cut(s) 127, 159
AluBI AGCT 2 cut(s) 102, 177
AluI AGCT 2 cut(s) 102, 177
AlwI GGATC 1 cut(s) 61
AspS9I GGNCC 1 cut(s) 433
AvaII GGWCC 1 cut(s) 433
BanII GRGCYC 1 cut(s) 79
BccI CCATC 2 cut(s) 457, 483
BciT130I CCWGG 1 cut(s) 46
BfaI CTAG 1 cut(s) 57
BfmI CTRYAG 1 cut(s) 224
Bme1390I CCNGG 1 cut(s) 46
Bme18I GGWCC 1 cut(s) 433
BmgT120I GGNCC 1 cut(s) 433
BmrFI CCNGG 1 cut(s) 46
BmrI ACTGGG 1 cut(s) 77
BmsI GCATC 2 cut(s) 430, 464
BmuI ACTGGG 1 cut(s) 77
BpuEI CTTGAG 2 cut(s) 63, 398
BsaJI CCNNGG 1 cut(s) 45
Bse1I ACTGG 2 cut(s) 72, 435
Bse3DI GCAATG 1 cut(s) 407
BseBI CCWGG 1 cut(s) 46
BseDI CCNNGG 1 cut(s) 45
BseGI GGATG 2 cut(s) 41, 397
BseMI GCAATG 1 cut(s) 407
BseMII CTCAG 1 cut(s) 493
BseNI ACTGG 2 cut(s) 72, 435
BsmI GAATGC 1 cut(s) 225
Bsp1286I GDGCHC 1 cut(s) 79
Bsp143I GATC 2 cut(s) 53, 295
BspACI CCGC 2 cut(s) 51, 73
BspCNI CTCAG 1 cut(s) 492
BspPI GGATC 1 cut(s) 61
BsrDI GCAATG 1 cut(s) 407
BsrI ACTGG 2 cut(s) 72, 435
BssECI CCNNGG 1 cut(s) 45
BssMI GATC 2 cut(s) 53, 295
BssNAI GTATAC 1 cut(s) 124
Bst1107I GTATAC 1 cut(s) 124
Bst2UI CCWGG 1 cut(s) 46
BstC8I GCNNGC 1 cut(s) 75
BstDEI CTNAG 1 cut(s) 479
BstF5I GGATG 2 cut(s) 41, 397
BstKTI GATC 2 cut(s) 56, 298
BstMBI GATC 2 cut(s) 53, 295
BstMWI GCNNNNNNNGC 2 cut(s) 331, 418
BstNI CCWGG 1 cut(s) 46
BstSCI CCNGG 1 cut(s) 44
BstSFI CTRYAG 1 cut(s) 224
BstX2I RGATCY 1 cut(s) 53
BstYI RGATCY 1 cut(s) 53
BstZ17I GTATAC 1 cut(s) 124
BtsCI GGATG 2 cut(s) 41, 397
BtsIMutI CAGTG 1 cut(s) 220
Cac8I GCNNGC 1 cut(s) 75
Cfr13I GGNCC 1 cut(s) 433
CseI GACGC 1 cut(s) 230
Csp6I GTAC 2 cut(s) 61, 170
CviAII CATG 5 cut(s) 204, 263, 267, 322, 350
CviJI RGCY 7 cut(s) 38, 77, 83, 102, 158, 177, 292
CviKI_1 RGCY 7 cut(s) 38, 77, 83, 102, 158, 177, 292
CviQI GTAC 2 cut(s) 61, 170
DdeI CTNAG 1 cut(s) 479
DpnI GATC 2 cut(s) 55, 297
DpnII GATC 2 cut(s) 53, 295
DraI TTTAAA 1 cut(s) 33
EciI GGCGGA 1 cut(s) 66
Eco24I GRGCYC 1 cut(s) 79
Eco47I GGWCC 1 cut(s) 433
EcoRII CCWGG 1 cut(s) 44
EcoT22I ATGCAT 1 cut(s) 268
EcoT38I GRGCYC 1 cut(s) 79
FaeI CATG 5 cut(s) 207, 266, 270, 325, 353
FaiI YATR 9 cut(s) 124, 142, 205, 264, 268, 278, 323, 351, 373
FatI CATG 5 cut(s) 203, 262, 266, 321, 349
FauI CCCGC 1 cut(s) 66
FblI GTMKAC 1 cut(s) 123
FokI GGATG 2 cut(s) 28, 384
FriOI GRGCYC 1 cut(s) 79
FspBI CTAG 1 cut(s) 57
HgaI GACGC 1 cut(s) 230
Hin1II CATG 5 cut(s) 207, 266, 270, 325, 353
HindIII AAGCTT 1 cut(s) 175
HinfI GANTC 3 cut(s) 230, 259, 346
Hpy166II GTNNAC 3 cut(s) 124, 365, 393
Hpy188I TCNGA 4 cut(s) 90, 345, 466, 482
Hpy8I GTNNAC 3 cut(s) 124, 365, 393
HpyCH4IV ACGT 1 cut(s) 355
HpyCH4V TGCA 4 cut(s) 266, 353, 455, 496
HpyF10VI GCNNNNNNNGC 2 cut(s) 331, 418
HpyF3I CTNAG 1 cut(s) 479
HpySE526I ACGT 1 cut(s) 355
Hsp92II CATG 5 cut(s) 207, 266, 270, 325, 353
Kzo9I GATC 2 cut(s) 53, 295
LmnI GCTCC 1 cut(s) 418
LpnPI CCDG 8 cut(s) 31, 53, 58, 212, 232, 320, 416, 449
LweI GCATC 2 cut(s) 430, 464
MaeI CTAG 1 cut(s) 57
MaeII ACGT 1 cut(s) 355
MaeIII GTNAC 1 cut(s) 242
MalI GATC 2 cut(s) 55, 297
MboI GATC 2 cut(s) 53, 295
MboII GAAGA 2 cut(s) 395, 416
MflI RGATCY 1 cut(s) 53
MhlI GDGCHC 1 cut(s) 79
MluCI AATT 3 cut(s) 113, 135, 339
MmeI TCCRAC 1 cut(s) 489
MnlI CCTC 3 cut(s) 218, 336, 472
Mph1103I ATGCAT 1 cut(s) 268
MseI TTAA 2 cut(s) 15, 32
MspR9I CCNGG 1 cut(s) 46
Mva1269I GAATGC 1 cut(s) 225
MvaI CCWGG 1 cut(s) 46
MwoI GCNNNNNNNGC 2 cut(s) 331, 418
NdeII GATC 2 cut(s) 53, 295
NlaIII CATG 5 cut(s) 207, 266, 270, 325, 353
NmuCI GTSAC 1 cut(s) 242
NsiI ATGCAT 1 cut(s) 268
PctI GAATGC 1 cut(s) 225
PfeI GAWTC 3 cut(s) 230, 259, 346
Psp6I CCWGG 1 cut(s) 44
PspGI CCWGG 1 cut(s) 44
PspPI GGNCC 1 cut(s) 433
PsuI RGATCY 1 cut(s) 53
RsaI GTAC 2 cut(s) 62, 171
RsaNI GTAC 2 cut(s) 61, 170
SaqAI TTAA 2 cut(s) 15, 32
Sau3AI GATC 2 cut(s) 53, 295
Sau96I GGNCC 1 cut(s) 433
ScrFI CCNGG 1 cut(s) 46
SduI GDGCHC 1 cut(s) 79
SetI ASST 7 cut(s) 62, 104, 179, 358, 464, 471, 495
SfaNI GCATC 2 cut(s) 430, 464
SfcI CTRYAG 1 cut(s) 224
SinI GGWCC 1 cut(s) 433
SmlI CTYRAG 2 cut(s) 78, 413
SmoI CTYRAG 2 cut(s) 78, 413
Sse9I AATT 3 cut(s) 113, 135, 339
SsiI CCGC 2 cut(s) 51, 73
SspI AATATT 1 cut(s) 28
SspMI CTAG 1 cut(s) 57
StyD4I CCNGG 1 cut(s) 44
TaiI ACGT 1 cut(s) 358
TaqI TCGA 3 cut(s) 164, 294, 458
TasI AATT 3 cut(s) 113, 135, 339
TfiI GAWTC 3 cut(s) 230, 259, 346
Tru1I TTAA 2 cut(s) 15, 32
Tru9I TTAA 2 cut(s) 15, 32
TscAI CASTG 1 cut(s) 220
TseFI GTSAC 1 cut(s) 242
Tsp45I GTSAC 1 cut(s) 242
TspDTI ATGAA 3 cut(s) 251, 293, 396
TspRI CASTG 1 cut(s) 220
VpaK11BI GGWCC 1 cut(s) 433
XmiI GTMKAC 1 cut(s) 123
XspI CTAG 1 cut(s) 57
Zsp2I ATGCAT 1 cut(s) 268
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.