RchiOBHm_Chr4g0429691

resistance protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
Physical Location & Seq
Forward (+)
54437105 .. 54437350
246 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 186 bp
ATGTCTAAAGAGAAAGGCCTATTCCATATACAAAAACAACTTTATCAAGACTTGTTGAAGAGCGAAGTGAAAATGCAGAATGTCAATCTGATAAGGAGTAGATTGCGTTACAAAAGGGTGCTTATCATTCTTGATGATGTGAATGAGTTAGAAACAAATAGAGGCTGTAGCCGGAAAGGATGGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

61

Amino Acids

7.33

Weight (kDa)

9.91

Isoelectric Point (pI)

56.0

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0022220)

Species Orthologous Gene IDs
fragaria_vesca FvH4_4g23371 FvH4_4g23371
rosa_chinensis RchiOBHm_Chr4g0429691
rosa_rugosa Rorug01G0149200.1

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 1 cut(s) 58
AoxI GGCC 1 cut(s) 16
BccI CCATC 1 cut(s) 174
BfmI CTRYAG 1 cut(s) 166
BseGI GGATG 1 cut(s) 185
BshFI GGCC 1 cut(s) 18
BsiSI CCGG 1 cut(s) 172
BsnI GGCC 1 cut(s) 18
BspANI GGCC 1 cut(s) 18
BspQI GCTCTTC 1 cut(s) 53
Bst6I CTCTTC 1 cut(s) 53
BstF5I GGATG 1 cut(s) 185
BstSFI CTRYAG 1 cut(s) 166
BsuRI GGCC 1 cut(s) 18
BtsCI GGATG 1 cut(s) 185
CviJI RGCY 3 cut(s) 18, 165, 171
CviKI_1 RGCY 3 cut(s) 18, 165, 171
Eam1104I CTCTTC 1 cut(s) 53
EarI CTCTTC 1 cut(s) 53
Eco147I AGGCCT 1 cut(s) 18
FaiI YATR 2 cut(s) 27, 29
FspEI CC 9 cut(s) 32, 38, 79, 100, 101, 147, 157, 162, 166
HaeIII GGCC 1 cut(s) 18
HapII CCGG 1 cut(s) 172
HpaII CCGG 1 cut(s) 172
Hpy188I TCNGA 1 cut(s) 90
Hpy188III TCNNGA 2 cut(s) 47, 131
HpyCH4V TGCA 1 cut(s) 76
LguI GCTCTTC 1 cut(s) 53
MaeIII GTNAC 1 cut(s) 107
MboII GAAGA 1 cut(s) 70
MnlI CCTC 1 cut(s) 155
MspI CCGG 1 cut(s) 172
PceI AGGCCT 1 cut(s) 18
PciSI GCTCTTC 1 cut(s) 53
SapI GCTCTTC 1 cut(s) 53
SfcI CTRYAG 1 cut(s) 166
SgeI CNNG 3 cut(s) 59, 64, 143
SseBI AGGCCT 1 cut(s) 18
StuI AGGCCT 1 cut(s) 18
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.