RchiOBHm_Chr4g0436071

nuclear matrix constituent protein 1-like

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
Physical Location & Seq
Forward (+)
59460674 .. 59462693
2020 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 333 bp
ATGATTCTTAAGCAAAAAGAGAGAGACCTTTATGAGGCTGAAAGGAAGATTGAGTCTTCAAACTCTCTGTTGAAAGAGAAGGAAGATGATGTGAATAAACGCCTAGCAGACCTAGTCTCAAAGGAAAAGGAGGTTCATTCAGCTTCATACATCTTAGAGATGAAGGAGAGAGAATTACATGCATTGGAGGAAAAACTAAATTCAAGAGAAATGTGGAGATTAAAGAGCACCTTGGCCAGCACAGGGCCATTCTTGATAGAAAAATGCAGGCTTTTGAGTAGGGAATTGAGGAAAGGAGGAAATCTTTTGAGAAGGAACAGAGTAGCAAGATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

110

Amino Acids

13.02

Weight (kDa)

9.58

Isoelectric Point (pI)

45.46

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0022727)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr4g0436071
rosa_multiflora Rmu_sc0023239.1_g000001
rosa_samantha Rh4BG354900 Rh4CG369400

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 234
AcsI RAATTY 1 cut(s) 199
AfiI CCNNNNNNNGG 2 cut(s) 34, 243
AflII CTTAAG 1 cut(s) 8
AgsI TTSAA 3 cut(s) 60, 73, 204
AluBI AGCT 1 cut(s) 143
AluI AGCT 1 cut(s) 143
Alw21I GWGCWC 1 cut(s) 230
Alw26I GTCTC 2 cut(s) 18, 121
AoxI GGCC 2 cut(s) 234, 245
ApoI RAATTY 1 cut(s) 199
AspS9I GGNCC 1 cut(s) 245
BalI TGGCCA 1 cut(s) 236
BbsI GAAGAC 1 cut(s) 48
Bbv12I GWGCWC 1 cut(s) 230
BcoDI GTCTC 2 cut(s) 18, 121
BfaI CTAG 2 cut(s) 104, 113
BfrI CTTAAG 1 cut(s) 8
BmgT120I GGNCC 1 cut(s) 245
BpiI GAAGAC 1 cut(s) 48
BsaI GGTCTC 1 cut(s) 18
BsaJI CCNNGG 1 cut(s) 231
Bsc4I CCNNNNNNNGG 2 cut(s) 34, 243
BseDI CCNNGG 1 cut(s) 231
BseLI CCNNNNNNNGG 2 cut(s) 34, 243
BshFI GGCC 2 cut(s) 236, 247
BsiHKAI GWGCWC 1 cut(s) 230
BslI CCNNNNNNNGG 2 cut(s) 34, 243
BsmAI GTCTC 2 cut(s) 18, 121
BsnI GGCC 2 cut(s) 236, 247
Bso31I GGTCTC 1 cut(s) 18
Bsp1286I GDGCHC 1 cut(s) 230
BspANI GGCC 2 cut(s) 236, 247
BspTI CTTAAG 1 cut(s) 8
BspTNI GGTCTC 1 cut(s) 18
BssECI CCNNGG 1 cut(s) 231
BssT1I CCWWGG 1 cut(s) 231
BstAFI CTTAAG 1 cut(s) 8
BstC8I GCNNGC 2 cut(s) 238, 269
BstDEI CTNAG 1 cut(s) 154
BstENI CCTNNNNNAGG 1 cut(s) 32
BstMAI GTCTC 2 cut(s) 18, 121
BstNSI RCATGY 1 cut(s) 182
BstV2I GAAGAC 1 cut(s) 48
BsuRI GGCC 2 cut(s) 236, 247
Cac8I GCNNGC 2 cut(s) 238, 269
Cfr13I GGNCC 1 cut(s) 245
CviAII CATG 1 cut(s) 179
CviJI RGCY 5 cut(s) 38, 143, 236, 247, 271
CviKI_1 RGCY 5 cut(s) 38, 143, 236, 247, 271
DdeI CTNAG 1 cut(s) 154
EaeI YGGCCR 1 cut(s) 234
Eco130I CCWWGG 1 cut(s) 231
Eco31I GGTCTC 1 cut(s) 18
EcoNI CCTNNNNNAGG 1 cut(s) 32
EcoT14I CCWWGG 1 cut(s) 231
EcoT22I ATGCAT 1 cut(s) 184
ErhI CCWWGG 1 cut(s) 231
FaeI CATG 1 cut(s) 182
FaiI YATR 3 cut(s) 33, 148, 180
FalI AAGNNNNNCTT 2 cut(s) 215, 247
FatI CATG 1 cut(s) 178
FspBI CTAG 2 cut(s) 104, 113
HaeIII GGCC 2 cut(s) 236, 247
Hin1II CATG 1 cut(s) 182
HinfI GANTC 2 cut(s) 4, 53
Hpy188III TCNNGA 2 cut(s) 204, 253
HpyAV CCTTC 3 cut(s) 73, 157, 306
HpyCH4V TGCA 2 cut(s) 182, 267
HpyF3I CTNAG 1 cut(s) 154
Hsp92II CATG 1 cut(s) 182
LpnPI CCDG 3 cut(s) 228, 250, 253
MaeI CTAG 2 cut(s) 104, 113
MboII GAAGA 3 cut(s) 48, 58, 95
MhlI GDGCHC 1 cut(s) 230
MlsI TGGCCA 1 cut(s) 236
MluCI AATT 3 cut(s) 173, 199, 284
MluNI TGGCCA 1 cut(s) 236
MlyI GAGTC 1 cut(s) 62
MnlI CCTC 5 cut(s) 28, 124, 181, 282, 290
Mox20I TGGCCA 1 cut(s) 236
Mph1103I ATGCAT 1 cut(s) 184
MscI TGGCCA 1 cut(s) 236
MseI TTAA 2 cut(s) 9, 221
Msp20I TGGCCA 1 cut(s) 236
MspCI CTTAAG 1 cut(s) 8
NlaIII CATG 1 cut(s) 182
NsiI ATGCAT 1 cut(s) 184
NspI RCATGY 1 cut(s) 182
PfeI GAWTC 1 cut(s) 4
PflFI GACNNNGTC 1 cut(s) 113
PleI GAGTC 1 cut(s) 61
PpsI GAGTC 1 cut(s) 61
PspPI GGNCC 1 cut(s) 245
PsyI GACNNNGTC 1 cut(s) 113
SaqAI TTAA 2 cut(s) 9, 221
Sau96I GGNCC 1 cut(s) 245
SchI GAGTC 1 cut(s) 62
SduI GDGCHC 1 cut(s) 230
SetI ASST 5 cut(s) 30, 114, 135, 145, 233
SgeI CNNG 9 cut(s) 116, 125, 191, 216, 244, 249, 255, 265, 280
SmlI CTYRAG 1 cut(s) 8
SmoI CTYRAG 1 cut(s) 8
Sse9I AATT 3 cut(s) 173, 199, 284
SspMI CTAG 2 cut(s) 104, 113
StyI CCWWGG 1 cut(s) 231
TasI AATT 3 cut(s) 173, 199, 284
TfiI GAWTC 1 cut(s) 4
Tru1I TTAA 2 cut(s) 9, 221
Tru9I TTAA 2 cut(s) 9, 221
TspDTI ATGAA 3 cut(s) 125, 135, 176
Tth111I GACNNNGTC 1 cut(s) 113
Vha464I CTTAAG 1 cut(s) 8
XagI CCTNNNNNAGG 1 cut(s) 32
XapI RAATTY 1 cut(s) 199
XceI RCATGY 1 cut(s) 182
XspI CTAG 2 cut(s) 104, 113
Zsp2I ATGCAT 1 cut(s) 184
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.