RchiOBHm_Chr4g0442661

PHD finger-like domain-containing protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
Physical Location & Seq
Reverse (-)
64133110 .. 64134566
1457 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 171 bp
ATGACCAAGCATCACCCTGATTTGATCATGTGCCGGAAGCAACTAGGGATTGTCATTGGGCCGCTCTGCCAGAACTGTGATGGGTCGTTGTGTTATCTATGGAGGAGTTGGGATTTCTTATGCTTACTATTGCTCATTTGTAGTTTTTGTGGAAAGAACTATTATGTATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

56

Amino Acids

6.53

Weight (kDa)

8.21

Isoelectric Point (pI)

25.07

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PHF5 PF03660 1 - 51 3.6e-09 PHF5-like protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0030042)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr4g0442661 RchiOBHm_Chr5g0075971

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 64
AciI CCGC 1 cut(s) 62
AoxI GGCC 1 cut(s) 59
AspS9I GGNCC 1 cut(s) 59
AsuHPI GGTGA 1 cut(s) 5
BccI CCATC 1 cut(s) 74
BclI TGATCA 1 cut(s) 24
BfaI CTAG 1 cut(s) 44
BisI GCNGC 1 cut(s) 62
BlsI GCNGC 1 cut(s) 63
BmgT120I GGNCC 1 cut(s) 59
BmsI GCATC 1 cut(s) 19
BseRI GAGGAG 1 cut(s) 118
BshFI GGCC 1 cut(s) 61
BsiSI CCGG 1 cut(s) 34
BsnI GGCC 1 cut(s) 61
Bsp143I GATC 1 cut(s) 24
BspACI CCGC 1 cut(s) 62
BspANI GGCC 1 cut(s) 61
BsrBI CCGCTC 1 cut(s) 64
BssMI GATC 1 cut(s) 24
Bst4CI ACNGT 1 cut(s) 77
BstKTI GATC 1 cut(s) 27
BstMBI GATC 1 cut(s) 24
BsuRI GGCC 1 cut(s) 61
Cfr13I GGNCC 1 cut(s) 59
CviAII CATG 1 cut(s) 28
CviJI RGCY 1 cut(s) 61
CviKI_1 RGCY 1 cut(s) 61
DpnI GATC 1 cut(s) 26
DpnII GATC 1 cut(s) 24
FaeI CATG 1 cut(s) 31
FaiI YATR 5 cut(s) 29, 100, 121, 165, 169
FatI CATG 1 cut(s) 27
FbaI TGATCA 1 cut(s) 24
Fnu4HI GCNGC 1 cut(s) 62
Fsp4HI GCNGC 1 cut(s) 62
FspBI CTAG 1 cut(s) 44
GluI GCNGC 1 cut(s) 62
HaeIII GGCC 1 cut(s) 61
HapII CCGG 1 cut(s) 34
Hin1II CATG 1 cut(s) 31
HpaII CCGG 1 cut(s) 34
HphI GGTGA 1 cut(s) 5
HpyCH4III ACNGT 1 cut(s) 77
Hsp92II CATG 1 cut(s) 31
Ksp22I TGATCA 1 cut(s) 24
Kzo9I GATC 1 cut(s) 24
LpnPI CCDG 3 cut(s) 30, 47, 83
LweI GCATC 1 cut(s) 19
MaeI CTAG 1 cut(s) 44
MalI GATC 1 cut(s) 26
MbiI CCGCTC 1 cut(s) 64
MboI GATC 1 cut(s) 24
MnlI CCTC 1 cut(s) 96
MspI CCGG 1 cut(s) 34
NdeII GATC 1 cut(s) 24
NlaIII CATG 1 cut(s) 31
PkrI GCNGC 1 cut(s) 63
PspPI GGNCC 1 cut(s) 59
SatI GCNGC 1 cut(s) 62
Sau3AI GATC 1 cut(s) 24
Sau96I GGNCC 1 cut(s) 59
SfaNI GCATC 1 cut(s) 19
SgeI CNNG 6 cut(s) 19, 29, 40, 46, 56, 82
SsiI CCGC 1 cut(s) 62
SspMI CTAG 1 cut(s) 44
TaaI ACNGT 1 cut(s) 77
TauI GCSGC 1 cut(s) 64
XcmI CCANNNNNNNNNTGG 1 cut(s) 77
XspI CTAG 1 cut(s) 44
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.