RchiOBHm_Chr5g0075971

PHD finger-like domain-containing protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
OG0030042
Physical Location & Seq
Reverse (-)
81684756 .. 81685960
1205 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ35067

Sequence Viewer

Length: 174 bp
ATGACCAAGCATCACCCTGATTTGATCATGTGCAGGAAGCAACTAGGGATTGTCATTGGGCCGCTCAGCCAGAAGTGTGATGGGTCGTTGTGTTATATGTGGAGGAGTTGGGATTTTTTATGCTTACTATTGCTCATTCGTAGTTTTTGTGGAAAGAACTATTATGTATGTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko03040 map03040
Pfam Domains
Protein Families
PHF5

Protein Analysis

57

Amino Acids

6.7

Weight (kDa)

8.86

Isoelectric Point (pI)

41.28

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PHF5 PF03660 1 - 29 3e-07 PHF5-like protein
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0030042)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr4g0442661 RchiOBHm_Chr5g0075971

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 64
AciI CCGC 1 cut(s) 62
AoxI GGCC 1 cut(s) 59
AspS9I GGNCC 1 cut(s) 59
AsuHPI GGTGA 1 cut(s) 5
BccI CCATC 1 cut(s) 74
BclI TGATCA 1 cut(s) 24
BfaI CTAG 1 cut(s) 44
BisI GCNGC 1 cut(s) 62
BlpI GCTNAGC 1 cut(s) 65
BlsI GCNGC 1 cut(s) 63
BmgT120I GGNCC 1 cut(s) 59
BmsI GCATC 1 cut(s) 19
Bpu1102I GCTNAGC 1 cut(s) 65
BseMII CTCAG 1 cut(s) 79
BseRI GAGGAG 1 cut(s) 118
BsgI GTGCAG 1 cut(s) 52
BshFI GGCC 1 cut(s) 61
BsnI GGCC 1 cut(s) 61
Bsp143I GATC 1 cut(s) 24
Bsp1720I GCTNAGC 1 cut(s) 65
BspACI CCGC 1 cut(s) 62
BspANI GGCC 1 cut(s) 61
BspCNI CTCAG 1 cut(s) 78
BsrBI CCGCTC 1 cut(s) 64
BssMI GATC 1 cut(s) 24
BstDEI CTNAG 1 cut(s) 65
BstKTI GATC 1 cut(s) 27
BstMBI GATC 1 cut(s) 24
BsuRI GGCC 1 cut(s) 61
Cfr13I GGNCC 1 cut(s) 59
CviAII CATG 1 cut(s) 28
CviJI RGCY 2 cut(s) 61, 69
CviKI_1 RGCY 2 cut(s) 61, 69
DdeI CTNAG 1 cut(s) 65
DpnI GATC 1 cut(s) 26
DpnII GATC 1 cut(s) 24
FaeI CATG 1 cut(s) 31
FaiI YATR 6 cut(s) 29, 96, 98, 121, 165, 169
FatI CATG 1 cut(s) 27
FbaI TGATCA 1 cut(s) 24
Fnu4HI GCNGC 1 cut(s) 62
Fsp4HI GCNGC 1 cut(s) 62
FspBI CTAG 1 cut(s) 44
GluI GCNGC 1 cut(s) 62
HaeIII GGCC 1 cut(s) 61
Hin1II CATG 1 cut(s) 31
HphI GGTGA 1 cut(s) 5
HpyCH4V TGCA 1 cut(s) 33
HpyF3I CTNAG 1 cut(s) 65
Hsp92II CATG 1 cut(s) 31
Ksp22I TGATCA 1 cut(s) 24
Kzo9I GATC 1 cut(s) 24
LpnPI CCDG 3 cut(s) 19, 30, 83
LweI GCATC 1 cut(s) 19
MaeI CTAG 1 cut(s) 44
MalI GATC 1 cut(s) 26
MbiI CCGCTC 1 cut(s) 64
MboI GATC 1 cut(s) 24
MnlI CCTC 1 cut(s) 96
NdeII GATC 1 cut(s) 24
NlaIII CATG 1 cut(s) 31
PkrI GCNGC 1 cut(s) 63
PspPI GGNCC 1 cut(s) 59
SatI GCNGC 1 cut(s) 62
Sau3AI GATC 1 cut(s) 24
Sau96I GGNCC 1 cut(s) 59
SfaNI GCATC 1 cut(s) 19
SgeI CNNG 6 cut(s) 19, 29, 40, 46, 56, 82
SsiI CCGC 1 cut(s) 62
SspMI CTAG 1 cut(s) 44
TauI GCSGC 1 cut(s) 64
XcmI CCANNNNNNNNNTGG 1 cut(s) 77
XspI CTAG 1 cut(s) 44
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.