RchiOBHm_Chr3g0477371

Prolycopene isomerase

Basic Information

Type: gene
Biological Identity
rosa_chinensis
3
Physical Location & Seq
Forward (+)
23219719 .. 23220638
920 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 159 bp
ATGCAGGCTATAGAAGGTCTTTACTGTGTTGGTGATAGCTACTTTCCAGGACAAGGAGTTAATGCTGTATCCTTCTCAGGACTAATGTATGCTCATCAAGTAGCTGTTGATATAGGCCTTGAGAAGAAGTCCCCAATATTGGATGATGCCCTTCTTTGA
Functional Annotation

Protein Analysis

52

Amino Acids

5.53

Weight (kDa)

4.23

Isoelectric Point (pI)

36.42

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0028717)

Species Orthologous Gene IDs
malus_domestica MD12G1045800.v1.1
rosa_chinensis RchiOBHm_Chr3g0477371

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfiI CCNNNNNNNGG 2 cut(s) 53, 139
AjnI CCWGG 1 cut(s) 46
AluBI AGCT 2 cut(s) 39, 104
AluI AGCT 2 cut(s) 39, 104
AoxI GGCC 1 cut(s) 115
AsuHPI GGTGA 1 cut(s) 44
BciT130I CCWGG 1 cut(s) 48
BciVI GTATCC 1 cut(s) 79
BfmI CTRYAG 1 cut(s) 9
BfuI GTATCC 1 cut(s) 79
Bme1390I CCNGG 1 cut(s) 48
BmrFI CCNGG 1 cut(s) 48
BmsI GCATC 1 cut(s) 136
BpuEI CTTGAG 1 cut(s) 140
Bsc4I CCNNNNNNNGG 2 cut(s) 53, 139
BseBI CCWGG 1 cut(s) 48
BseGI GGATG 1 cut(s) 148
BseLI CCNNNNNNNGG 2 cut(s) 53, 139
BseMII CTCAG 1 cut(s) 90
BshFI GGCC 1 cut(s) 117
BslFI GGGAC 1 cut(s) 115
BslI CCNNNNNNNGG 2 cut(s) 53, 139
BsmFI GGGAC 1 cut(s) 115
BsnI GGCC 1 cut(s) 117
BspANI GGCC 1 cut(s) 117
BspCNI CTCAG 1 cut(s) 89
Bst2UI CCWGG 1 cut(s) 48
Bst4CI ACNGT 1 cut(s) 26
BstC8I GCNNGC 1 cut(s) 6
BstDEI CTNAG 1 cut(s) 76
BstF5I GGATG 1 cut(s) 148
BstNI CCWGG 1 cut(s) 48
BstSCI CCNGG 1 cut(s) 46
BstSFI CTRYAG 1 cut(s) 9
BsuI GTATCC 1 cut(s) 79
BsuRI GGCC 1 cut(s) 117
BtsCI GGATG 1 cut(s) 148
Cac8I GCNNGC 1 cut(s) 6
CviJI RGCY 4 cut(s) 8, 39, 104, 117
CviKI_1 RGCY 4 cut(s) 8, 39, 104, 117
DdeI CTNAG 1 cut(s) 76
Eco147I AGGCCT 1 cut(s) 117
EcoRII CCWGG 1 cut(s) 46
FaiI YATR 3 cut(s) 11, 90, 113
FaqI GGGAC 1 cut(s) 115
FokI GGATG 1 cut(s) 155
HaeIII GGCC 1 cut(s) 117
HphI GGTGA 1 cut(s) 44
Hpy188III TCNNGA 1 cut(s) 78
HpyAV CCTTC 2 cut(s) 8, 82
HpyCH4III ACNGT 1 cut(s) 26
HpyCH4V TGCA 1 cut(s) 4
HpyF3I CTNAG 1 cut(s) 76
LpnPI CCDG 3 cut(s) 33, 60, 63
LweI GCATC 1 cut(s) 136
MboII GAAGA 1 cut(s) 136
MseI TTAA 1 cut(s) 60
MspR9I CCNGG 1 cut(s) 48
MvaI CCWGG 1 cut(s) 48
PceI AGGCCT 1 cut(s) 117
PfoI TCCNGGA 1 cut(s) 46
Psp6I CCWGG 1 cut(s) 46
PspGI CCWGG 1 cut(s) 46
SaqAI TTAA 1 cut(s) 60
ScrFI CCNGG 1 cut(s) 48
SetI ASST 3 cut(s) 19, 41, 106
SfaNI GCATC 1 cut(s) 136
SfcI CTRYAG 1 cut(s) 9
SgeI CNNG 7 cut(s) 17, 59, 60, 65, 90, 110, 131
SmlI CTYRAG 1 cut(s) 119
SmoI CTYRAG 1 cut(s) 119
SseBI AGGCCT 1 cut(s) 117
SspI AATATT 1 cut(s) 138
StuI AGGCCT 1 cut(s) 117
StyD4I CCNGG 1 cut(s) 46
TaaI ACNGT 1 cut(s) 26
Tru1I TTAA 1 cut(s) 60
Tru9I TTAA 1 cut(s) 60
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.