RchiOBHm_Chr3g0487451

f-box protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
3
Physical Location & Seq
Forward (+)
34692896 .. 34695012
2117 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 240 bp
ATGGAAGGGGGTTTTACTAGCCACCATAAGCACTTTCCCTCCAAATTTGGGTTTCACTTTTTGGGGTTTCTTCTAGATTTGGAGACGAACATCATCGCTTCAGTATTCCAATTCTCTTTTTGGGTTTTGACATCATCAGGATCTGCAAGCGGTGTGTGTAGAAATTGGAAACAGGGGGTGAAGCAGAGTCTGGGACGCAGAGACAATTTGAGCTTTGCTGGTTGGAAGATGGATTCTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

79

Amino Acids

8.9

Weight (kDa)

9.51

Isoelectric Point (pI)

47.56

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0021375)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr3g0487451 RchiOBHm_Chr5g0029101 RchiOBHm_Chr7g0228241
rosa_laevigata RLG00000027662
rosa_samantha Rh5BG369000

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 150
AclWI GGATC 1 cut(s) 148
AcsI RAATTY 1 cut(s) 44
AcuI CTGAAG 1 cut(s) 84
AfiI CCNNNNNNNGG 1 cut(s) 48
AluBI AGCT 1 cut(s) 213
AluI AGCT 1 cut(s) 213
Alw26I GTCTC 2 cut(s) 77, 195
AlwI GGATC 1 cut(s) 148
AlwNI CAGNNNCTG 2 cut(s) 143, 190
ApoI RAATTY 1 cut(s) 44
AsuHPI GGTGA 1 cut(s) 190
BccI CCATC 1 cut(s) 223
BcoDI GTCTC 2 cut(s) 77, 195
BfaI CTAG 2 cut(s) 18, 74
BsaXI ACNNNNNCTCC 2 cut(s) 23, 53
Bsc4I CCNNNNNNNGG 1 cut(s) 48
BseLI CCNNNNNNNGG 1 cut(s) 48
BslFI GGGAC 1 cut(s) 207
BslI CCNNNNNNNGG 1 cut(s) 48
BsmAI GTCTC 2 cut(s) 77, 195
BsmBI CGTCTC 1 cut(s) 77
BsmFI GGGAC 1 cut(s) 207
Bsp143I GATC 1 cut(s) 140
BspACI CCGC 1 cut(s) 150
BspPI GGATC 1 cut(s) 148
BssMI GATC 1 cut(s) 140
BstC8I GCNNGC 1 cut(s) 148
BstDEI CTNAG 1 cut(s) 237
BstKTI GATC 1 cut(s) 143
BstMAI GTCTC 2 cut(s) 77, 195
BstMBI GATC 1 cut(s) 140
BstX2I RGATCY 1 cut(s) 140
BstYI RGATCY 1 cut(s) 140
BtgZI GCGATG 1 cut(s) 79
Cac8I GCNNGC 1 cut(s) 148
CaiI CAGNNNCTG 2 cut(s) 143, 190
CseI GACGC 1 cut(s) 204
CviJI RGCY 2 cut(s) 21, 213
CviKI_1 RGCY 2 cut(s) 21, 213
DdeI CTNAG 1 cut(s) 237
DpnI GATC 1 cut(s) 142
DpnII GATC 1 cut(s) 140
Eco57I CTGAAG 1 cut(s) 84
Esp3I CGTCTC 1 cut(s) 77
FaiI YATR 1 cut(s) 27
FaqI GGGAC 1 cut(s) 207
FspBI CTAG 2 cut(s) 18, 74
HgaI GACGC 1 cut(s) 204
HinfI GANTC 2 cut(s) 187, 233
HphI GGTGA 1 cut(s) 190
Hpy188III TCNNGA 2 cut(s) 74, 138
HpyCH4V TGCA 1 cut(s) 146
HpyF3I CTNAG 1 cut(s) 237
Kzo9I GATC 1 cut(s) 140
LpnPI CCDG 4 cut(s) 123, 158, 176, 204
MaeI CTAG 2 cut(s) 18, 74
MalI GATC 1 cut(s) 142
MboI GATC 1 cut(s) 140
MboII GAAGA 2 cut(s) 62, 238
MflI RGATCY 1 cut(s) 140
MluCI AATT 4 cut(s) 44, 110, 163, 205
MlyI GAGTC 1 cut(s) 196
MmeI TCCRAC 1 cut(s) 203
MnlI CCTC 1 cut(s) 49
NdeII GATC 1 cut(s) 140
PfeI GAWTC 1 cut(s) 233
PleI GAGTC 1 cut(s) 195
PpsI GAGTC 1 cut(s) 195
PstNI CAGNNNCTG 2 cut(s) 143, 190
PsuI RGATCY 1 cut(s) 140
Sau3AI GATC 1 cut(s) 140
SchI GAGTC 1 cut(s) 196
SetI ASST 1 cut(s) 215
SgeI CNNG 7 cut(s) 30, 86, 150, 159, 185, 203, 231
Sse9I AATT 4 cut(s) 44, 110, 163, 205
SsiI CCGC 1 cut(s) 150
SspMI CTAG 2 cut(s) 18, 74
TasI AATT 4 cut(s) 44, 110, 163, 205
TfiI GAWTC 1 cut(s) 233
XapI RAATTY 1 cut(s) 44
XbaI TCTAGA 1 cut(s) 73
XspI CTAG 2 cut(s) 18, 74
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.