RchiOBHm_Chr2g0088771

Sel1-like repeats.

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Reverse (-)
3197189 .. 3198660
1472 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 216 bp
ATGGGTGATGCAGATGCACAATATGAACTCGCTTGTCGTCTTAGAGTTGAGAATGAGTATGTCCAATCGGATCAGCAAGCTTTCCATTATCTGGAGAAGGCAGTTGACCAGGATTCAACTTTTAGTTATGTCGTTTTTAAGCTTTGGTCAGCTTGTGTGTCTTTAAGAAGGTGGAGGCATCTTAGCTTGAAGCATTTGGTTTTGGGACAGAAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

71

Amino Acids

8.38

Weight (kDa)

6.81

Isoelectric Point (pI)

61.09

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0029713)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr2g0088771 RchiOBHm_Chr2g0088931

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 91
AclWI GGATC 1 cut(s) 78
AfiI CCNNNNNNNGG 1 cut(s) 91
AgsI TTSAA 2 cut(s) 117, 190
AjnI CCWGG 1 cut(s) 108
AluBI AGCT 4 cut(s) 80, 142, 152, 186
AluI AGCT 4 cut(s) 80, 142, 152, 186
AlwI GGATC 1 cut(s) 78
AsuHPI GGTGA 1 cut(s) 17
BciT130I CCWGG 1 cut(s) 110
Bme1390I CCNGG 1 cut(s) 110
BmrFI CCNGG 1 cut(s) 110
BmsI GCATC 2 cut(s) 4, 187
BpmI CTGGAG 1 cut(s) 113
Bsc4I CCNNNNNNNGG 1 cut(s) 91
BseBI CCWGG 1 cut(s) 110
BseLI CCNNNNNNNGG 1 cut(s) 91
BslI CCNNNNNNNGG 1 cut(s) 91
Bsp143I GATC 1 cut(s) 70
BspPI GGATC 1 cut(s) 78
BssMI GATC 1 cut(s) 70
Bst2UI CCWGG 1 cut(s) 110
BstC8I GCNNGC 1 cut(s) 78
BstDEI CTNAG 2 cut(s) 41, 182
BstKTI GATC 1 cut(s) 73
BstMBI GATC 1 cut(s) 70
BstNI CCWGG 1 cut(s) 110
BstSCI CCNGG 1 cut(s) 108
Cac8I GCNNGC 1 cut(s) 78
CviJI RGCY 4 cut(s) 80, 142, 152, 186
CviKI_1 RGCY 4 cut(s) 80, 142, 152, 186
DdeI CTNAG 2 cut(s) 41, 182
DpnI GATC 1 cut(s) 72
DpnII GATC 1 cut(s) 70
EcoRII CCWGG 1 cut(s) 108
FaiI YATR 3 cut(s) 24, 60, 129
GsuI CTGGAG 1 cut(s) 113
HincII GTYRAC 1 cut(s) 106
HindII GTYRAC 1 cut(s) 106
HindIII AAGCTT 2 cut(s) 78, 140
HinfI GANTC 1 cut(s) 113
HphI GGTGA 1 cut(s) 17
Hpy166II GTNNAC 1 cut(s) 106
Hpy188I TCNGA 1 cut(s) 70
Hpy188III TCNNGA 1 cut(s) 92
Hpy8I GTNNAC 1 cut(s) 106
HpyAV CCTTC 2 cut(s) 91, 162
HpyCH4V TGCA 2 cut(s) 11, 17
HpyF3I CTNAG 2 cut(s) 41, 182
Kzo9I GATC 1 cut(s) 70
LpnPI CCDG 3 cut(s) 77, 95, 122
LweI GCATC 2 cut(s) 4, 187
MalI GATC 1 cut(s) 72
MboI GATC 1 cut(s) 70
MnlI CCTC 1 cut(s) 168
MseI TTAA 2 cut(s) 138, 164
MspR9I CCNGG 1 cut(s) 110
MvaI CCWGG 1 cut(s) 110
NdeII GATC 1 cut(s) 70
PfeI GAWTC 1 cut(s) 113
PflMI CCANNNNNTGG 1 cut(s) 91
Psp6I CCWGG 1 cut(s) 108
PspGI CCWGG 1 cut(s) 108
SaqAI TTAA 2 cut(s) 138, 164
Sau3AI GATC 1 cut(s) 70
ScrFI CCNGG 1 cut(s) 110
SetI ASST 5 cut(s) 82, 144, 154, 173, 188
SfaNI GCATC 2 cut(s) 4, 187
SgeI CNNG 8 cut(s) 41, 45, 89, 104, 121, 122, 165, 199
StyD4I CCNGG 1 cut(s) 108
TfiI GAWTC 1 cut(s) 113
Tru1I TTAA 2 cut(s) 138, 164
Tru9I TTAA 2 cut(s) 138, 164
TspDTI ATGAA 1 cut(s) 39
Van91I CCANNNNNTGG 1 cut(s) 91
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.