RchiOBHm_Chr2g0088931

Sel1-like repeats.

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Reverse (-)
3265461 .. 3266219
759 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ46423

Sequence Viewer

Length: 159 bp
ATGGGTGATGCAGATGCACAATATGAACTCGCTTGTCGTCTTAGAGTTGAGAATGAGTATGTCCAATCGGATCAGCAAGCTTTCCATTATCTGGAGAAGGCAGTTGACCAGGATGGAAGCTTAAGCAGTCATATATGCATCCAAGGATTCAACTTTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

52

Amino Acids

5.94

Weight (kDa)

4.35

Isoelectric Point (pI)

48.11

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0029713)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr2g0088771 RchiOBHm_Chr2g0088931

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 91
AclWI GGATC 1 cut(s) 78
AfiI CCNNNNNNNGG 1 cut(s) 91
AflII CTTAAG 1 cut(s) 121
AgsI TTSAA 1 cut(s) 151
AjnI CCWGG 1 cut(s) 108
AluBI AGCT 2 cut(s) 80, 120
AluI AGCT 2 cut(s) 80, 120
AlwI GGATC 1 cut(s) 78
AsuHPI GGTGA 1 cut(s) 17
BccI CCATC 1 cut(s) 107
BciT130I CCWGG 1 cut(s) 110
BfrI CTTAAG 1 cut(s) 121
Bme1390I CCNGG 1 cut(s) 110
BmrFI CCNGG 1 cut(s) 110
BmsI GCATC 2 cut(s) 4, 147
BpmI CTGGAG 1 cut(s) 113
BsaJI CCNNGG 1 cut(s) 142
Bsc4I CCNNNNNNNGG 1 cut(s) 91
BseBI CCWGG 1 cut(s) 110
BseDI CCNNGG 1 cut(s) 142
BseGI GGATG 2 cut(s) 118, 138
BseLI CCNNNNNNNGG 1 cut(s) 91
BslI CCNNNNNNNGG 1 cut(s) 91
Bsp143I GATC 1 cut(s) 70
BspPI GGATC 1 cut(s) 78
BspTI CTTAAG 1 cut(s) 121
BssECI CCNNGG 1 cut(s) 142
BssMI GATC 1 cut(s) 70
BssT1I CCWWGG 1 cut(s) 142
Bst2UI CCWGG 1 cut(s) 110
BstAFI CTTAAG 1 cut(s) 121
BstC8I GCNNGC 1 cut(s) 78
BstDEI CTNAG 1 cut(s) 41
BstF5I GGATG 2 cut(s) 118, 138
BstKTI GATC 1 cut(s) 73
BstMBI GATC 1 cut(s) 70
BstNI CCWGG 1 cut(s) 110
BstSCI CCNGG 1 cut(s) 108
BtsCI GGATG 2 cut(s) 118, 138
Cac8I GCNNGC 1 cut(s) 78
CviJI RGCY 2 cut(s) 80, 120
CviKI_1 RGCY 2 cut(s) 80, 120
DdeI CTNAG 1 cut(s) 41
DpnI GATC 1 cut(s) 72
DpnII GATC 1 cut(s) 70
Eco130I CCWWGG 1 cut(s) 142
EcoRII CCWGG 1 cut(s) 108
EcoT14I CCWWGG 1 cut(s) 142
EcoT22I ATGCAT 1 cut(s) 140
ErhI CCWWGG 1 cut(s) 142
FaiI YATR 5 cut(s) 24, 60, 132, 134, 136
FokI GGATG 2 cut(s) 125, 125
GsuI CTGGAG 1 cut(s) 113
HincII GTYRAC 1 cut(s) 106
HindII GTYRAC 1 cut(s) 106
HindIII AAGCTT 2 cut(s) 78, 118
HinfI GANTC 1 cut(s) 147
HphI GGTGA 1 cut(s) 17
Hpy166II GTNNAC 1 cut(s) 106
Hpy188I TCNGA 1 cut(s) 70
Hpy188III TCNNGA 1 cut(s) 92
Hpy8I GTNNAC 1 cut(s) 106
HpyAV CCTTC 1 cut(s) 91
HpyCH4V TGCA 3 cut(s) 11, 17, 138
HpyF3I CTNAG 1 cut(s) 41
Kzo9I GATC 1 cut(s) 70
LpnPI CCDG 3 cut(s) 77, 95, 122
LweI GCATC 2 cut(s) 4, 147
MalI GATC 1 cut(s) 72
MboI GATC 1 cut(s) 70
Mph1103I ATGCAT 1 cut(s) 140
MseI TTAA 1 cut(s) 122
MspCI CTTAAG 1 cut(s) 121
MspR9I CCNGG 1 cut(s) 110
MvaI CCWGG 1 cut(s) 110
NdeII GATC 1 cut(s) 70
NsiI ATGCAT 1 cut(s) 140
PfeI GAWTC 1 cut(s) 147
PflMI CCANNNNNTGG 1 cut(s) 91
Psp6I CCWGG 1 cut(s) 108
PspGI CCWGG 1 cut(s) 108
SaqAI TTAA 1 cut(s) 122
Sau3AI GATC 1 cut(s) 70
ScrFI CCNGG 1 cut(s) 110
SetI ASST 2 cut(s) 82, 122
SfaNI GCATC 2 cut(s) 4, 147
SgeI CNNG 7 cut(s) 41, 45, 89, 104, 121, 122, 155
SmlI CTYRAG 1 cut(s) 121
SmoI CTYRAG 1 cut(s) 121
StyD4I CCNGG 1 cut(s) 108
StyI CCWWGG 1 cut(s) 142
TfiI GAWTC 1 cut(s) 147
Tru1I TTAA 1 cut(s) 122
Tru9I TTAA 1 cut(s) 122
TspDTI ATGAA 1 cut(s) 39
Van91I CCANNNNNTGG 1 cut(s) 91
Vha464I CTTAAG 1 cut(s) 121
Zsp2I ATGCAT 1 cut(s) 140
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.