RchiOBHm_Chr2g0111981

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Reverse (-)
23729469 .. 23732008
2540 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 222 bp
ATGGCTAGAGCAAAGCTCCAAAGAGAGACGAATTCCGAAGTTACAATGAGAAATTCAAAGTGCTTCGATATGAATGACGCACTCTTCGATTTGAAGATTCGTCAAAGCACAGTCAAAATTTTGGCTGCCCTCCGACAATCGAAGTCGGCTTCTCTTTCCTTTATGCAACAACCTCATTGCCTCACCATTCCTGATTTTGCAGGTATGGAATCAAGATACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

73

Amino Acids

8.36

Weight (kDa)

9.51

Isoelectric Point (pI)

45.68

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0029888)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr2g0111981
rosa_samantha Rh2CG234100

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 191
AcsI RAATTY 3 cut(s) 31, 52, 117
AgsI TTSAA 2 cut(s) 57, 94
AluBI AGCT 1 cut(s) 16
AluI AGCT 1 cut(s) 16
Alw26I GTCTC 1 cut(s) 20
ApeKI GCWGC 1 cut(s) 125
ApoI RAATTY 3 cut(s) 31, 52, 117
ArsI GACNNNNNNTTYG 2 cut(s) 68, 100
AsuHPI GGTGA 1 cut(s) 175
BbvI GCAGC 1 cut(s) 112
BcoDI GTCTC 1 cut(s) 20
BfaI CTAG 2 cut(s) 6, 220
BfuAI ACCTGC 1 cut(s) 191
BisI GCNGC 1 cut(s) 126
BlsI GCNGC 1 cut(s) 127
BplI GAGNNNNNCTC 1 cut(s) 32
Bse3DI GCAATG 1 cut(s) 175
BseMI GCAATG 1 cut(s) 175
BseXI GCAGC 1 cut(s) 112
BsmAI GTCTC 1 cut(s) 20
BsmBI CGTCTC 1 cut(s) 20
BspMI ACCTGC 1 cut(s) 191
BsrDI GCAATG 1 cut(s) 175
Bst4CI ACNGT 1 cut(s) 112
Bst6I CTCTTC 1 cut(s) 89
BstMAI GTCTC 1 cut(s) 20
BstV1I GCAGC 1 cut(s) 112
BveI ACCTGC 1 cut(s) 191
CseI GACGC 1 cut(s) 86
CviJI RGCY 4 cut(s) 5, 16, 125, 149
CviKI_1 RGCY 4 cut(s) 5, 16, 125, 149
Eam1104I CTCTTC 1 cut(s) 89
EarI CTCTTC 1 cut(s) 89
EcoRI GAATTC 1 cut(s) 31
Esp3I CGTCTC 1 cut(s) 20
FaiI YATR 3 cut(s) 71, 164, 206
Fnu4HI GCNGC 1 cut(s) 126
Fsp4HI GCNGC 1 cut(s) 126
FspBI CTAG 2 cut(s) 6, 220
GluI GCNGC 1 cut(s) 126
HgaI GACGC 1 cut(s) 86
HinfI GANTC 2 cut(s) 97, 209
HphI GGTGA 1 cut(s) 175
Hpy188I TCNGA 2 cut(s) 37, 134
Hpy188III TCNNGA 2 cut(s) 191, 213
HpyCH4III ACNGT 1 cut(s) 112
HpyCH4V TGCA 2 cut(s) 166, 200
LmnI GCTCC 1 cut(s) 21
LpnPI CCDG 2 cut(s) 186, 204
Lsp1109I GCAGC 1 cut(s) 112
MaeI CTAG 2 cut(s) 6, 220
MaeIII GTNAC 1 cut(s) 40
MboII GAAGA 2 cut(s) 76, 106
MluCI AATT 3 cut(s) 31, 52, 117
MmeI TCCRAC 1 cut(s) 157
MnlI CCTC 3 cut(s) 140, 183, 191
PcsI WCGNNNNNNNCGW 1 cut(s) 84
PfeI GAWTC 2 cut(s) 97, 209
PkrI GCNGC 1 cut(s) 127
SatI GCNGC 1 cut(s) 126
SetI ASST 3 cut(s) 18, 175, 205
SgeI CNNG 3 cut(s) 18, 203, 213
Sse9I AATT 3 cut(s) 31, 52, 117
SspMI CTAG 2 cut(s) 6, 220
TaaI ACNGT 1 cut(s) 112
TaqI TCGA 3 cut(s) 66, 87, 140
TasI AATT 3 cut(s) 31, 52, 117
TfiI GAWTC 2 cut(s) 97, 209
TseI GCWGC 1 cut(s) 125
TspDTI ATGAA 1 cut(s) 86
XapI RAATTY 3 cut(s) 31, 52, 117
XspI CTAG 2 cut(s) 6, 220
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.