RchiOBHm_Chr2g0118491

ribosomal protein L23

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Forward (+)
30722884 .. 30723165
282 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 282 bp
ATGGATGGAATCAAATATGCAGTATTTACAGACAAAAGTATTCGGTTATTGGGGAAAAATCAATATACTTTTAATGTCGAATCAGGATCAACTAGGACAGAAATAAAGCATTGGGTCGAACTCTTCTTTGGTGTCAAGGTAATAGCTATGAATAGTCATCGACTCCTGGGAAAGGGTAGAAGAATGGGACCTACTATGGGACATACAATGCATTACAGACGTATGATCATTACGCTTCAACCTGGTTATTCTATTCCACCTCTTAGAAAGAAAAGGACTTAA

Protein Analysis

93

Amino Acids

10.8

Weight (kDa)

10.82

Isoelectric Point (pI)

41.18

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Ribosomal_L23 PF00276 4 - 85 4.1e-22 Ribosomal protein L23
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0020938)

Species Orthologous Gene IDs
arabidopsis_thaliana ATCG00840 ATCG01300
rosa_chinensis RchiOBHm_Chr2g0118491 RchiOBHm_CPg0502591
rosa_rugosa RorugMtG0003500.1

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 94
AfiI CCNNNNNNNGG 2 cut(s) 172, 197
AgsI TTSAA 1 cut(s) 239
AjnI CCWGG 2 cut(s) 165, 241
AjuI GAANNNNNNNTTGG 2 cut(s) 111, 143
AluBI AGCT 1 cut(s) 146
AluI AGCT 1 cut(s) 146
AlwI GGATC 1 cut(s) 94
AspS9I GGNCC 1 cut(s) 188
AvaII GGWCC 1 cut(s) 188
BciT130I CCWGG 2 cut(s) 167, 243
BclI TGATCA 1 cut(s) 225
BfaI CTAG 1 cut(s) 93
Bme1390I CCNGG 2 cut(s) 167, 243
Bme18I GGWCC 1 cut(s) 188
BmgT120I GGNCC 1 cut(s) 188
BmiI GGNNCC 1 cut(s) 189
BmrFI CCNGG 2 cut(s) 167, 243
BsaJI CCNNGG 1 cut(s) 166
Bsc4I CCNNNNNNNGG 2 cut(s) 172, 197
BseBI CCWGG 2 cut(s) 167, 243
BseDI CCNNGG 1 cut(s) 166
BseGI GGATG 1 cut(s) 10
BseLI CCNNNNNNNGG 2 cut(s) 172, 197
BslFI GGGAC 2 cut(s) 201, 213
BslI CCNNNNNNNGG 2 cut(s) 172, 197
BsmFI GGGAC 2 cut(s) 201, 213
Bsp143I GATC 2 cut(s) 86, 225
BspLI GGNNCC 1 cut(s) 189
BspPI GGATC 1 cut(s) 94
BssECI CCNNGG 1 cut(s) 166
BssMI GATC 2 cut(s) 86, 225
Bst2UI CCWGG 2 cut(s) 167, 243
Bst6I CTCTTC 1 cut(s) 128
BstDEI CTNAG 1 cut(s) 263
BstENI CCTNNNNNAGG 1 cut(s) 170
BstF5I GGATG 1 cut(s) 10
BstKTI GATC 2 cut(s) 89, 228
BstMBI GATC 2 cut(s) 86, 225
BstNI CCWGG 2 cut(s) 167, 243
BstSCI CCNGG 2 cut(s) 165, 241
BtsCI GGATG 1 cut(s) 10
Cfr13I GGNCC 1 cut(s) 188
CsiI ACCWGGT 1 cut(s) 241
CviJI RGCY 1 cut(s) 146
CviKI_1 RGCY 1 cut(s) 146
DdeI CTNAG 1 cut(s) 263
DpnI GATC 2 cut(s) 88, 227
DpnII GATC 2 cut(s) 86, 225
Eam1104I CTCTTC 1 cut(s) 128
EarI CTCTTC 1 cut(s) 128
Eco47I GGWCC 1 cut(s) 188
EcoNI CCTNNNNNAGG 1 cut(s) 170
EcoO109I RGGNCCY 1 cut(s) 188
EcoRII CCWGG 2 cut(s) 165, 241
EcoT22I ATGCAT 1 cut(s) 213
FaiI YATR 6 cut(s) 18, 66, 149, 197, 204, 224
FaqI GGGAC 2 cut(s) 201, 213
FbaI TGATCA 1 cut(s) 225
FokI GGATG 1 cut(s) 17
FspBI CTAG 1 cut(s) 93
HinfI GANTC 3 cut(s) 9, 80, 162
Hpy188III TCNNGA 1 cut(s) 84
HpyCH4IV ACGT 1 cut(s) 220
HpyCH4V TGCA 2 cut(s) 20, 211
HpyF3I CTNAG 1 cut(s) 263
HpySE526I ACGT 1 cut(s) 220
Ksp22I TGATCA 1 cut(s) 225
Kzo9I GATC 2 cut(s) 86, 225
LpnPI CCDG 5 cut(s) 69, 152, 179, 228, 255
MabI ACCWGGT 1 cut(s) 241
MaeI CTAG 1 cut(s) 93
MaeII ACGT 1 cut(s) 220
MalI GATC 2 cut(s) 88, 227
MboI GATC 2 cut(s) 86, 225
MboII GAAGA 2 cut(s) 115, 192
MlyI GAGTC 1 cut(s) 156
MnlI CCTC 1 cut(s) 270
Mph1103I ATGCAT 1 cut(s) 213
MseI TTAA 2 cut(s) 72, 280
MspR9I CCNGG 2 cut(s) 167, 243
MvaI CCWGG 2 cut(s) 167, 243
NdeII GATC 2 cut(s) 86, 225
NlaIV GGNNCC 1 cut(s) 189
NsiI ATGCAT 1 cut(s) 213
PfeI GAWTC 2 cut(s) 9, 80
PleI GAGTC 1 cut(s) 156
PpsI GAGTC 1 cut(s) 156
PpuMI RGGWCCY 1 cut(s) 188
Psp5II RGGWCCY 1 cut(s) 188
Psp6I CCWGG 2 cut(s) 165, 241
PspGI CCWGG 2 cut(s) 165, 241
PspN4I GGNNCC 1 cut(s) 189
PspPI GGNCC 1 cut(s) 188
PspPPI RGGWCCY 1 cut(s) 188
SaqAI TTAA 2 cut(s) 72, 280
Sau3AI GATC 2 cut(s) 86, 225
Sau96I GGNCC 1 cut(s) 188
SchI GAGTC 1 cut(s) 156
ScrFI CCNGG 2 cut(s) 167, 243
SetI ASST 6 cut(s) 141, 148, 193, 223, 244, 262
SexAI ACCWGGT 1 cut(s) 241
SgeI CNNG 7 cut(s) 96, 105, 148, 178, 179, 254, 255
SinI GGWCC 1 cut(s) 188
SspMI CTAG 1 cut(s) 93
StyD4I CCNGG 2 cut(s) 165, 241
TaiI ACGT 1 cut(s) 223
TaqI TCGA 3 cut(s) 78, 117, 160
TfiI GAWTC 2 cut(s) 9, 80
Tru1I TTAA 2 cut(s) 72, 280
Tru9I TTAA 2 cut(s) 72, 280
TspDTI ATGAA 1 cut(s) 164
VpaK11BI GGWCC 1 cut(s) 188
XagI CCTNNNNNAGG 1 cut(s) 170
XspI CTAG 1 cut(s) 93
Zsp2I ATGCAT 1 cut(s) 213
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.