Basic Information

Type: gene

Biological Identity

Species

rosa_chinensis

Chromosome

Orthogroup ID

OG0020938

Physical Location & Seq

Genomic Coordinates Forward (+)

30722884 .. 30723165

Gene Structure 282 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

PRQ49128

Sequence Viewer

CDS Protein Promoter (2k)

Length: 282 bp

ATGGATGGAATCAAATATGCAGTATTTACAGACAAAAGTATTCGGTTATTGGGGAAAAATCAATATACTTTTAATGTCGAATCAGGATCAACTAGGACAGAAATAAAGCATTGGGTCGAACTCTTCTTTGGTGTCAAGGTAATAGCTATGAATAGTCATCGACTCCTGGGAAAGGGTAGAAGAATGGGACCTACTATGGGACATACAATGCATTACAGACGTATGATCATTACGCTTCAACCTGGTTATTCTATTCCACCTCTTAGAAAGAAAAGGACTTAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000027 GO:0003674 GO:0003676 GO:0003723 GO:0003735 GO:0005198 GO:0005488 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005829 GO:0005840 GO:0006996 GO:0008150 GO:0009507 GO:0009526 GO:0009532 GO:0009536 GO:0009570 GO:0009941 GO:0009987 GO:0015934 GO:0016043 GO:0022607 GO:0022613 GO:0022618 GO:0022625 GO:0022626 GO:0031967 GO:0031975 GO:0032991 GO:0034622 GO:0042254 GO:0042255 GO:0042273 GO:0043226 GO:0043227 GO:0043228 GO:0043229 GO:0043231 GO:0043232 GO:0043933 GO:0044085 GO:0044391 GO:0044422 GO:0044424 GO:0044434 GO:0044435 GO:0044444 GO:0044445 GO:0044446 GO:0044464 GO:0065003 GO:0070925 GO:0071826 GO:0071840 GO:0097159 GO:1901363 GO:1990904

KEGG Pathways

Metabolic & Signaling

ko03010 map03010

Pfam Domains

Protein Families

Ribosomal_L23

Protein Analysis

93

Amino Acids

10.8

Weight (kDa)

10.82

Isoelectric Point (pI)

41.18

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
Ribosomal_L23	PF00276	4 - 85	4.1e-22	Ribosomal protein L23

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0020938)

Species	Orthologous Gene IDs
arabidopsis_thaliana	ATCG00840 ATCG01300
rosa_chinensis	RchiOBHm_Chr2g0118491 RchiOBHm_CPg0502591
rosa_rugosa	RorugMtG0003500.1

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AclWI	GGATC	1 cut(s)	94
AfiI	CCNNNNNNNGG	2 cut(s)	172, 197
AgsI	TTSAA	1 cut(s)	239
AjnI	CCWGG	2 cut(s)	165, 241
AjuI	GAANNNNNNNTTGG	2 cut(s)	111, 143
AluBI	AGCT	1 cut(s)	146
AluI	AGCT	1 cut(s)	146
AlwI	GGATC	1 cut(s)	94
AspS9I	GGNCC	1 cut(s)	188
AvaII	GGWCC	1 cut(s)	188
BciT130I	CCWGG	2 cut(s)	167, 243
BclI	TGATCA	1 cut(s)	225
BfaI	CTAG	1 cut(s)	93
Bme1390I	CCNGG	2 cut(s)	167, 243
Bme18I	GGWCC	1 cut(s)	188
BmgT120I	GGNCC	1 cut(s)	188
BmiI	GGNNCC	1 cut(s)	189
BmrFI	CCNGG	2 cut(s)	167, 243
BsaJI	CCNNGG	1 cut(s)	166
Bsc4I	CCNNNNNNNGG	2 cut(s)	172, 197
BseBI	CCWGG	2 cut(s)	167, 243
BseDI	CCNNGG	1 cut(s)	166
BseGI	GGATG	1 cut(s)	10
BseLI	CCNNNNNNNGG	2 cut(s)	172, 197
BslFI	GGGAC	2 cut(s)	201, 213
BslI	CCNNNNNNNGG	2 cut(s)	172, 197
BsmFI	GGGAC	2 cut(s)	201, 213
Bsp143I	GATC	2 cut(s)	86, 225
BspLI	GGNNCC	1 cut(s)	189
BspPI	GGATC	1 cut(s)	94
BssECI	CCNNGG	1 cut(s)	166
BssMI	GATC	2 cut(s)	86, 225
Bst2UI	CCWGG	2 cut(s)	167, 243
Bst6I	CTCTTC	1 cut(s)	128
BstDEI	CTNAG	1 cut(s)	263
BstENI	CCTNNNNNAGG	1 cut(s)	170
BstF5I	GGATG	1 cut(s)	10
BstKTI	GATC	2 cut(s)	89, 228
BstMBI	GATC	2 cut(s)	86, 225
BstNI	CCWGG	2 cut(s)	167, 243
BstSCI	CCNGG	2 cut(s)	165, 241
BtsCI	GGATG	1 cut(s)	10
Cfr13I	GGNCC	1 cut(s)	188
CsiI	ACCWGGT	1 cut(s)	241
CviJI	RGCY	1 cut(s)	146
CviKI_1	RGCY	1 cut(s)	146
DdeI	CTNAG	1 cut(s)	263
DpnI	GATC	2 cut(s)	88, 227
DpnII	GATC	2 cut(s)	86, 225
Eam1104I	CTCTTC	1 cut(s)	128
EarI	CTCTTC	1 cut(s)	128
Eco47I	GGWCC	1 cut(s)	188
EcoNI	CCTNNNNNAGG	1 cut(s)	170
EcoO109I	RGGNCCY	1 cut(s)	188
EcoRII	CCWGG	2 cut(s)	165, 241
EcoT22I	ATGCAT	1 cut(s)	213
FaiI	YATR	6 cut(s)	18, 66, 149, 197, 204, 224
FaqI	GGGAC	2 cut(s)	201, 213
FbaI	TGATCA	1 cut(s)	225
FokI	GGATG	1 cut(s)	17
FspBI	CTAG	1 cut(s)	93
HinfI	GANTC	3 cut(s)	9, 80, 162
Hpy188III	TCNNGA	1 cut(s)	84
HpyCH4IV	ACGT	1 cut(s)	220
HpyCH4V	TGCA	2 cut(s)	20, 211
HpyF3I	CTNAG	1 cut(s)	263
HpySE526I	ACGT	1 cut(s)	220
Ksp22I	TGATCA	1 cut(s)	225
Kzo9I	GATC	2 cut(s)	86, 225
LpnPI	CCDG	5 cut(s)	69, 152, 179, 228, 255
MabI	ACCWGGT	1 cut(s)	241
MaeI	CTAG	1 cut(s)	93
MaeII	ACGT	1 cut(s)	220
MalI	GATC	2 cut(s)	88, 227
MboI	GATC	2 cut(s)	86, 225
MboII	GAAGA	2 cut(s)	115, 192
MlyI	GAGTC	1 cut(s)	156
MnlI	CCTC	1 cut(s)	270
Mph1103I	ATGCAT	1 cut(s)	213
MseI	TTAA	2 cut(s)	72, 280
MspR9I	CCNGG	2 cut(s)	167, 243
MvaI	CCWGG	2 cut(s)	167, 243
NdeII	GATC	2 cut(s)	86, 225
NlaIV	GGNNCC	1 cut(s)	189
NsiI	ATGCAT	1 cut(s)	213
PfeI	GAWTC	2 cut(s)	9, 80
PleI	GAGTC	1 cut(s)	156
PpsI	GAGTC	1 cut(s)	156
PpuMI	RGGWCCY	1 cut(s)	188
Psp5II	RGGWCCY	1 cut(s)	188
Psp6I	CCWGG	2 cut(s)	165, 241
PspGI	CCWGG	2 cut(s)	165, 241
PspN4I	GGNNCC	1 cut(s)	189
PspPI	GGNCC	1 cut(s)	188
PspPPI	RGGWCCY	1 cut(s)	188
SaqAI	TTAA	2 cut(s)	72, 280
Sau3AI	GATC	2 cut(s)	86, 225
Sau96I	GGNCC	1 cut(s)	188
SchI	GAGTC	1 cut(s)	156
ScrFI	CCNGG	2 cut(s)	167, 243
SetI	ASST	6 cut(s)	141, 148, 193, 223, 244, 262
SexAI	ACCWGGT	1 cut(s)	241
SgeI	CNNG	7 cut(s)	96, 105, 148, 178, 179, 254, 255
SinI	GGWCC	1 cut(s)	188
SspMI	CTAG	1 cut(s)	93
StyD4I	CCNGG	2 cut(s)	165, 241
TaiI	ACGT	1 cut(s)	223
TaqI	TCGA	3 cut(s)	78, 117, 160
TfiI	GAWTC	2 cut(s)	9, 80
Tru1I	TTAA	2 cut(s)	72, 280
Tru9I	TTAA	2 cut(s)	72, 280
TspDTI	ATGAA	1 cut(s)	164
VpaK11BI	GGWCC	1 cut(s)	188
XagI	CCTNNNNNAGG	1 cut(s)	170
XspI	CTAG	1 cut(s)	93
Zsp2I	ATGCAT	1 cut(s)	213

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.