RchiOBHm_Chr2g0121891

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Forward (+)
34756353 .. 34758562
2210 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 156 bp
ATGCGAGCTACAATATCAAGAAGGCTTCATCAGGCAGTAGATGACATATGTCAACGACGAGGAACAGATGGTACTGCAGATTTAGAATTTGGGAGGTTTTGGTGTGAAACTAGGAACTTTACGAGAAGATGGTTCATGGTTGTTCTTTATATTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

51

Amino Acids

6.2

Weight (kDa)

9.67

Isoelectric Point (pI)

45.42

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0029896)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr2g0121891 RchiOBHm_Chr7g0192171

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 86
AfaI GTAC 1 cut(s) 73
AluBI AGCT 1 cut(s) 8
AluI AGCT 1 cut(s) 8
ApoI RAATTY 1 cut(s) 86
BccI CCATC 2 cut(s) 62, 123
BfaI CTAG 1 cut(s) 111
BfmI CTRYAG 1 cut(s) 75
BoxI GACNNNNGTC 1 cut(s) 48
BspMAI CTGCAG 1 cut(s) 79
BstC8I GCNNGC 1 cut(s) 6
BstPAI GACNNNNGTC 1 cut(s) 48
BstSFI CTRYAG 1 cut(s) 75
Cac8I GCNNGC 1 cut(s) 6
Csp6I GTAC 1 cut(s) 72
CviAII CATG 1 cut(s) 136
CviJI RGCY 2 cut(s) 8, 25
CviKI_1 RGCY 2 cut(s) 8, 25
CviQI GTAC 1 cut(s) 72
FaeI CATG 1 cut(s) 139
FaiI YATR 4 cut(s) 47, 49, 137, 150
FatI CATG 1 cut(s) 135
FauNDI CATATG 1 cut(s) 47
FspBI CTAG 1 cut(s) 111
Hin1II CATG 1 cut(s) 139
HincII GTYRAC 1 cut(s) 53
HindII GTYRAC 1 cut(s) 53
Hpy166II GTNNAC 1 cut(s) 53
Hpy188III TCNNGA 1 cut(s) 18
Hpy8I GTNNAC 1 cut(s) 53
Hpy99I CGWCG 1 cut(s) 60
HpyAV CCTTC 1 cut(s) 15
HpyCH4V TGCA 1 cut(s) 77
Hsp92II CATG 1 cut(s) 139
LpnPI CCDG 1 cut(s) 17
MaeI CTAG 1 cut(s) 111
MboII GAAGA 1 cut(s) 138
MluCI AATT 1 cut(s) 86
MnlI CCTC 2 cut(s) 53, 87
NdeI CATATG 1 cut(s) 47
NlaIII CATG 1 cut(s) 139
PshAI GACNNNNGTC 1 cut(s) 48
PsrI GAACNNNNNNTAC 2 cut(s) 55, 87
PstI CTGCAG 1 cut(s) 79
RsaI GTAC 1 cut(s) 73
RsaNI GTAC 1 cut(s) 72
SetI ASST 2 cut(s) 10, 98
SfcI CTRYAG 1 cut(s) 75
SgeI CNNG 7 cut(s) 17, 30, 44, 71, 123, 135, 148
Sse9I AATT 1 cut(s) 86
SspMI CTAG 1 cut(s) 111
TasI AATT 1 cut(s) 86
TspDTI ATGAA 2 cut(s) 17, 124
XapI RAATTY 1 cut(s) 86
XspI CTAG 1 cut(s) 111
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.