RchiOBHm_Chr7g0192171

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
Physical Location & Seq
Forward (+)
10716427 .. 10718558
2132 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ17174

Sequence Viewer

Length: 207 bp
ATGCGAGCTACAGTATCAAGAATGCTTCATCAGGAAGTAGATGACATATGTCAACAAAGAGGAACAACTGGTTTGTTTGCGGATCTCATGGAAGATTTTGTTAATGCATCAGATTTTATGGATTATCTTGAGGCAACTTGGTATCCTAGAATTTGTTTAGGATGCAGGTCATTGGCCAATCATACAGTAGCTTATGAAATCATTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

68

Amino Acids

7.83

Weight (kDa)

4.59

Isoelectric Point (pI)

17.95

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0029896)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr2g0121891 RchiOBHm_Chr7g0192171

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 156
AciI CCGC 1 cut(s) 80
AclWI GGATC 1 cut(s) 90
AcoI YGGCCR 1 cut(s) 174
AcsI RAATTY 1 cut(s) 150
AluBI AGCT 2 cut(s) 8, 191
AluI AGCT 2 cut(s) 8, 191
AlwI GGATC 1 cut(s) 90
AoxI GGCC 1 cut(s) 174
ApoI RAATTY 1 cut(s) 150
BalI TGGCCA 1 cut(s) 176
BciVI GTATCC 1 cut(s) 153
BfaI CTAG 1 cut(s) 147
BfmI CTRYAG 1 cut(s) 9
BfuAI ACCTGC 1 cut(s) 156
BfuI GTATCC 1 cut(s) 153
BmsI GCATC 2 cut(s) 116, 152
BoxI GACNNNNGTC 1 cut(s) 48
BpuEI CTTGAG 1 cut(s) 149
Bse1I ACTGG 1 cut(s) 73
BseGI GGATG 1 cut(s) 167
BseNI ACTGG 1 cut(s) 73
BshFI GGCC 1 cut(s) 176
BsmI GAATGC 1 cut(s) 27
BsnI GGCC 1 cut(s) 176
Bsp143I GATC 1 cut(s) 82
BspACI CCGC 1 cut(s) 80
BspANI GGCC 1 cut(s) 176
BspMI ACCTGC 1 cut(s) 156
BspPI GGATC 1 cut(s) 90
BsrI ACTGG 1 cut(s) 73
BssMI GATC 1 cut(s) 82
Bst4CI ACNGT 2 cut(s) 13, 187
BstC8I GCNNGC 1 cut(s) 6
BstF5I GGATG 1 cut(s) 167
BstKTI GATC 1 cut(s) 85
BstMBI GATC 1 cut(s) 82
BstPAI GACNNNNGTC 1 cut(s) 48
BstSFI CTRYAG 1 cut(s) 9
BstX2I RGATCY 1 cut(s) 82
BstYI RGATCY 1 cut(s) 82
BsuI GTATCC 1 cut(s) 153
BsuRI GGCC 1 cut(s) 176
BtsCI GGATG 1 cut(s) 167
BveI ACCTGC 1 cut(s) 156
Cac8I GCNNGC 1 cut(s) 6
CviAII CATG 1 cut(s) 88
CviJI RGCY 3 cut(s) 8, 176, 191
CviKI_1 RGCY 3 cut(s) 8, 176, 191
DpnI GATC 1 cut(s) 84
DpnII GATC 1 cut(s) 82
EaeI YGGCCR 1 cut(s) 174
EcoT22I ATGCAT 1 cut(s) 109
FaeI CATG 1 cut(s) 91
FaiI YATR 6 cut(s) 47, 49, 89, 119, 183, 195
FatI CATG 1 cut(s) 87
FauNDI CATATG 1 cut(s) 47
FokI GGATG 1 cut(s) 174
FspBI CTAG 1 cut(s) 147
HaeIII GGCC 1 cut(s) 176
Hin1II CATG 1 cut(s) 91
HincII GTYRAC 1 cut(s) 53
HindII GTYRAC 1 cut(s) 53
Hpy166II GTNNAC 1 cut(s) 53
Hpy188I TCNGA 1 cut(s) 112
Hpy188III TCNNGA 3 cut(s) 18, 32, 128
Hpy8I GTNNAC 1 cut(s) 53
HpyCH4III ACNGT 2 cut(s) 13, 187
HpyCH4V TGCA 2 cut(s) 107, 165
Hsp92II CATG 1 cut(s) 91
Kzo9I GATC 1 cut(s) 82
LpnPI CCDG 3 cut(s) 17, 54, 151
LweI GCATC 2 cut(s) 116, 152
MaeI CTAG 1 cut(s) 147
MalI GATC 1 cut(s) 84
MboI GATC 1 cut(s) 82
MboII GAAGA 1 cut(s) 104
MflI RGATCY 1 cut(s) 82
MlsI TGGCCA 1 cut(s) 176
MluCI AATT 1 cut(s) 150
MluNI TGGCCA 1 cut(s) 176
MnlI CCTC 2 cut(s) 53, 124
Mox20I TGGCCA 1 cut(s) 176
Mph1103I ATGCAT 1 cut(s) 109
MscI TGGCCA 1 cut(s) 176
MseI TTAA 1 cut(s) 102
Msp20I TGGCCA 1 cut(s) 176
Mva1269I GAATGC 1 cut(s) 27
NdeI CATATG 1 cut(s) 47
NdeII GATC 1 cut(s) 82
NlaIII CATG 1 cut(s) 91
NsiI ATGCAT 1 cut(s) 109
PctI GAATGC 1 cut(s) 27
PshAI GACNNNNGTC 1 cut(s) 48
PsuI RGATCY 1 cut(s) 82
SaqAI TTAA 1 cut(s) 102
Sau3AI GATC 1 cut(s) 82
SetI ASST 3 cut(s) 10, 170, 193
SfaNI GCATC 2 cut(s) 116, 152
SfcI CTRYAG 1 cut(s) 9
SgeI CNNG 9 cut(s) 17, 30, 44, 81, 100, 140, 150, 159, 178
SmlI CTYRAG 1 cut(s) 128
SmoI CTYRAG 1 cut(s) 128
Sse9I AATT 1 cut(s) 150
SsiI CCGC 1 cut(s) 80
SspMI CTAG 1 cut(s) 147
TaaI ACNGT 2 cut(s) 13, 187
TasI AATT 1 cut(s) 150
Tru1I TTAA 1 cut(s) 102
Tru9I TTAA 1 cut(s) 102
TspDTI ATGAA 1 cut(s) 17
XapI RAATTY 1 cut(s) 150
XspI CTAG 1 cut(s) 147
Zsp2I ATGCAT 1 cut(s) 109
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.