RchiOBHm_Chr2g0124091

Pentatricopeptide repeat-containing protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Reverse (-)
37435904 .. 37436080
177 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 177 bp
ATGCCAATTGCACCAGATGCCAATATTTGGGGTTCTTTGCTTGGGGCATGTCAAATCCATGGGAACATAAAGTTGGCGAGTTGGGCAGCAAAGTGTAAGTTAAAACCTGATCATTGTGGGTACTACACACTTTTGGCTTACATGTATGTGCAGAAGCAGGGAGATGGGAAGACGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

58

Amino Acids

6.35

Weight (kDa)

8.89

Isoelectric Point (pI)

38.9

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0024818)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr2g0124091
rosa_laevigata RLG00000018780
rosa_multiflora Rmu_sc0008812.1_g000012

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 27
AfaI GTAC 1 cut(s) 122
AfiI CCNNNNNNNGG 1 cut(s) 27
AflIII ACRYGT 1 cut(s) 141
AjuI GAANNNNNNNTTGG 2 cut(s) 56, 88
ApeKI GCWGC 1 cut(s) 86
BbvI GCAGC 1 cut(s) 98
BccI CCATC 1 cut(s) 158
BclI TGATCA 1 cut(s) 109
BisI GCNGC 1 cut(s) 87
BlsI GCNGC 1 cut(s) 88
BmsI GCATC 1 cut(s) 7
BsaJI CCNNGG 1 cut(s) 58
Bsc4I CCNNNNNNNGG 1 cut(s) 27
BseDI CCNNGG 1 cut(s) 58
BseLI CCNNNNNNNGG 1 cut(s) 27
BseXI GCAGC 1 cut(s) 98
BsgI GTGCAG 1 cut(s) 170
BslI CCNNNNNNNGG 1 cut(s) 27
Bsp143I GATC 1 cut(s) 109
Bsp19I CCATGG 1 cut(s) 58
BssECI CCNNGG 1 cut(s) 58
BssMI GATC 1 cut(s) 109
BssT1I CCWWGG 1 cut(s) 58
BstAPI GCANNNNNTGC 1 cut(s) 17
BstDSI CCRYGG 1 cut(s) 58
BstKTI GATC 1 cut(s) 112
BstMBI GATC 1 cut(s) 109
BstMWI GCNNNNNNNGC 2 cut(s) 17, 83
BstNSI RCATGY 2 cut(s) 51, 145
BstV1I GCAGC 1 cut(s) 98
BtgI CCRYGG 1 cut(s) 58
Csp6I GTAC 1 cut(s) 121
CviAII CATG 3 cut(s) 48, 59, 142
CviJI RGCY 1 cut(s) 137
CviKI_1 RGCY 1 cut(s) 137
CviQI GTAC 1 cut(s) 121
DpnI GATC 1 cut(s) 111
DpnII GATC 1 cut(s) 109
Eco130I CCWWGG 1 cut(s) 58
EcoT14I CCWWGG 1 cut(s) 58
ErhI CCWWGG 1 cut(s) 58
FaeI CATG 3 cut(s) 51, 62, 145
FaiI YATR 5 cut(s) 49, 60, 68, 143, 147
FatI CATG 3 cut(s) 47, 58, 141
FbaI TGATCA 1 cut(s) 109
Fnu4HI GCNGC 1 cut(s) 87
Fsp4HI GCNGC 1 cut(s) 87
GluI GCNGC 1 cut(s) 87
Hin1II CATG 3 cut(s) 51, 62, 145
HpyCH4IV ACGT 1 cut(s) 173
HpyCH4V TGCA 2 cut(s) 11, 151
HpyF10VI GCNNNNNNNGC 2 cut(s) 17, 83
HpySE526I ACGT 1 cut(s) 173
Hsp92II CATG 3 cut(s) 51, 62, 145
Ksp22I TGATCA 1 cut(s) 109
Kzo9I GATC 1 cut(s) 109
LpnPI CCDG 3 cut(s) 27, 120, 143
Lsp1109I GCAGC 1 cut(s) 98
LweI GCATC 1 cut(s) 7
MaeII ACGT 1 cut(s) 173
MalI GATC 1 cut(s) 111
MboI GATC 1 cut(s) 109
MfeI CAATTG 1 cut(s) 6
MluCI AATT 1 cut(s) 6
MseI TTAA 1 cut(s) 101
MslI CAYNNNNRTG 1 cut(s) 146
MunI CAATTG 1 cut(s) 6
MwoI GCNNNNNNNGC 2 cut(s) 17, 83
NcoI CCATGG 1 cut(s) 58
NdeII GATC 1 cut(s) 109
NlaIII CATG 3 cut(s) 51, 62, 145
NspI RCATGY 2 cut(s) 51, 145
PciI ACATGT 1 cut(s) 141
PflMI CCANNNNNTGG 1 cut(s) 27
PkrI GCNGC 1 cut(s) 88
PscI ACATGT 1 cut(s) 141
RsaI GTAC 1 cut(s) 122
RsaNI GTAC 1 cut(s) 121
RseI CAYNNNNRTG 1 cut(s) 146
SaqAI TTAA 1 cut(s) 101
SatI GCNGC 1 cut(s) 87
Sau3AI GATC 1 cut(s) 109
SetI ASST 2 cut(s) 109, 176
SfaNI GCATC 1 cut(s) 7
SgeI CNNG 8 cut(s) 26, 53, 60, 71, 90, 119, 154, 170
SmiMI CAYNNNNRTG 1 cut(s) 146
Sse9I AATT 1 cut(s) 6
SspI AATATT 1 cut(s) 25
StyI CCWWGG 1 cut(s) 58
TaiI ACGT 1 cut(s) 176
TasI AATT 1 cut(s) 6
Tru1I TTAA 1 cut(s) 101
Tru9I TTAA 1 cut(s) 101
TseI GCWGC 1 cut(s) 86
Van91I CCANNNNNTGG 1 cut(s) 27
XceI RCATGY 2 cut(s) 51, 145
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.