RchiOBHm_Chr2g0135531

Amidohydrolase

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Reverse (-)
52620202 .. 52621050
849 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 192 bp
ATGAAAAACCCAGTTCAGACTATATGCTGCAACAATGGCTGTAGGGGAGCCCAGAGCACCAAAGTAATAAATTCACATCTCCATGTTTGGGCTTTTCCTCAGAAGGCTGCTGGTAAATATCCTTACTTTCCTGGCCAAGAACCCACTTTGCCTGGGGATATCGATTTGTTGCTTCAGGTATGGCTTTCATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

63

Amino Acids

6.98

Weight (kDa)

8.57

Isoelectric Point (pI)

35.49

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0024789)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr1g0319171 RchiOBHm_Chr2g0135531
rosa_laevigata RLG00000023655

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 133
AcsI RAATTY 1 cut(s) 70
AcuI CTGAAG 1 cut(s) 158
AfiI CCNNNNNNNGG 1 cut(s) 88
AjnI CCWGG 2 cut(s) 130, 151
Alw21I GWGCWC 1 cut(s) 59
AoxI GGCC 1 cut(s) 133
ApeKI GCWGC 2 cut(s) 27, 107
ApoI RAATTY 1 cut(s) 70
BalI TGGCCA 1 cut(s) 135
BanII GRGCYC 1 cut(s) 52
Bbv12I GWGCWC 1 cut(s) 59
BbvI GCAGC 2 cut(s) 14, 94
BciT130I CCWGG 2 cut(s) 132, 153
BfmI CTRYAG 1 cut(s) 40
BisI GCNGC 2 cut(s) 28, 108
BlsI GCNGC 2 cut(s) 29, 109
Bme1390I CCNGG 2 cut(s) 132, 153
BmiI GGNNCC 1 cut(s) 49
BmrFI CCNGG 2 cut(s) 132, 153
BmrI ACTGGG 1 cut(s) 5
BmuI ACTGGG 1 cut(s) 5
Bsa29I ATCGAT 1 cut(s) 162
BsaJI CCNNGG 1 cut(s) 152
Bsc4I CCNNNNNNNGG 1 cut(s) 88
Bse1I ACTGG 1 cut(s) 11
BseBI CCWGG 2 cut(s) 132, 153
BseCI ATCGAT 1 cut(s) 162
BseDI CCNNGG 1 cut(s) 152
BseLI CCNNNNNNNGG 1 cut(s) 88
BseMII CTCAG 1 cut(s) 113
BseNI ACTGG 1 cut(s) 11
BseXI GCAGC 2 cut(s) 14, 94
BshFI GGCC 1 cut(s) 135
BshVI ATCGAT 1 cut(s) 162
BsiHKAI GWGCWC 1 cut(s) 59
BslI CCNNNNNNNGG 1 cut(s) 88
BsnI GGCC 1 cut(s) 135
Bsp1286I GDGCHC 2 cut(s) 52, 59
BspANI GGCC 1 cut(s) 135
BspCNI CTCAG 1 cut(s) 112
BspDI ATCGAT 1 cut(s) 162
BspHI TCATGA 1 cut(s) 188
BspLI GGNNCC 1 cut(s) 49
BsrI ACTGG 1 cut(s) 11
BssECI CCNNGG 1 cut(s) 152
Bst2UI CCWGG 2 cut(s) 132, 153
BstDEI CTNAG 1 cut(s) 99
BstMWI GCNNNNNNNGC 1 cut(s) 36
BstNI CCWGG 2 cut(s) 132, 153
BstSCI CCNGG 2 cut(s) 130, 151
BstSFI CTRYAG 1 cut(s) 40
BstV1I GCAGC 2 cut(s) 14, 94
Bsu15I ATCGAT 1 cut(s) 162
BsuRI GGCC 1 cut(s) 135
BsuTUI ATCGAT 1 cut(s) 162
CciI TCATGA 1 cut(s) 188
ClaI ATCGAT 1 cut(s) 162
CviAII CATG 2 cut(s) 83, 189
CviJI RGCY 6 cut(s) 39, 50, 92, 107, 135, 184
CviKI_1 RGCY 6 cut(s) 39, 50, 92, 107, 135, 184
DdeI CTNAG 1 cut(s) 99
EaeI YGGCCR 1 cut(s) 133
Eco24I GRGCYC 1 cut(s) 52
Eco32I GATATC 1 cut(s) 160
Eco57I CTGAAG 1 cut(s) 158
EcoRII CCWGG 2 cut(s) 130, 151
EcoRV GATATC 1 cut(s) 160
EcoT38I GRGCYC 1 cut(s) 52
FaeI CATG 2 cut(s) 86, 192
FaiI YATR 5 cut(s) 23, 25, 84, 181, 190
FatI CATG 2 cut(s) 82, 188
Fnu4HI GCNGC 2 cut(s) 28, 108
FriOI GRGCYC 1 cut(s) 52
Fsp4HI GCNGC 2 cut(s) 28, 108
GluI GCNGC 2 cut(s) 28, 108
HaeIII GGCC 1 cut(s) 135
Hin1II CATG 2 cut(s) 86, 192
Hpy188I TCNGA 2 cut(s) 18, 102
Hpy188III TCNNGA 1 cut(s) 189
HpyAV CCTTC 1 cut(s) 97
HpyCH4V TGCA 1 cut(s) 30
HpyF10VI GCNNNNNNNGC 1 cut(s) 36
HpyF3I CTNAG 1 cut(s) 99
Hsp92II CATG 2 cut(s) 86, 192
LmnI GCTCC 1 cut(s) 47
LpnPI CCDG 8 cut(s) 24, 65, 96, 117, 138, 144, 161, 165
Lsp1109I GCAGC 2 cut(s) 14, 94
MhlI GDGCHC 2 cut(s) 52, 59
MlsI TGGCCA 1 cut(s) 135
MluCI AATT 1 cut(s) 70
MluNI TGGCCA 1 cut(s) 135
MnlI CCTC 1 cut(s) 108
Mox20I TGGCCA 1 cut(s) 135
MscI TGGCCA 1 cut(s) 135
MslI CAYNNNNRTG 1 cut(s) 81
Msp20I TGGCCA 1 cut(s) 135
MspR9I CCNGG 2 cut(s) 132, 153
MvaI CCWGG 2 cut(s) 132, 153
MwoI GCNNNNNNNGC 1 cut(s) 36
NlaIII CATG 2 cut(s) 86, 192
NlaIV GGNNCC 1 cut(s) 49
PagI TCATGA 1 cut(s) 188
PkrI GCNGC 2 cut(s) 29, 109
Psp6I CCWGG 2 cut(s) 130, 151
PspGI CCWGG 2 cut(s) 130, 151
PspN4I GGNNCC 1 cut(s) 49
RseI CAYNNNNRTG 1 cut(s) 81
SatI GCNGC 2 cut(s) 28, 108
ScrFI CCNGG 2 cut(s) 132, 153
SduI GDGCHC 2 cut(s) 52, 59
SetI ASST 1 cut(s) 180
SfcI CTRYAG 1 cut(s) 40
SmiMI CAYNNNNRTG 1 cut(s) 81
Sse9I AATT 1 cut(s) 70
StyD4I CCNGG 2 cut(s) 130, 151
TaqI TCGA 1 cut(s) 162
TasI AATT 1 cut(s) 70
TseI GCWGC 2 cut(s) 27, 107
TspDTI ATGAA 2 cut(s) 17, 177
XapI RAATTY 1 cut(s) 70
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.