RchiOBHm_Chr2g0147961

Meiotic recombination protein DMC1 homolog

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Reverse (-)
65570809 .. 65573819
3011 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 180 bp
ATGATGGCTAAAAATTATCTTAGACAATTTCCACCTGGTTTGATGGATGTGTTCTTCCTAACTAAGTGCACTTCCAGTAAACCTGAAAGACTTGTACCAATAGCTGAAAGATTTGGCTTGGACCCAGGAGCTGTCCTCGACAAAAGCTGCTACTTTTCCATATTATATCAGTTGAACTAG

Protein Analysis

59

Amino Acids

6.76

Weight (kDa)

8.71

Isoelectric Point (pI)

42.85

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0029845)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr2g0147961
rosa_rugosa Rorug03G0310400

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 96
AgsI TTSAA 1 cut(s) 175
AjnI CCWGG 2 cut(s) 34, 124
AluBI AGCT 3 cut(s) 104, 131, 147
AluI AGCT 3 cut(s) 104, 131, 147
Alw21I GWGCWC 1 cut(s) 71
Alw44I GTGCAC 1 cut(s) 67
AlwNI CAGNNNCTG 1 cut(s) 131
ApaLI GTGCAC 1 cut(s) 67
ApeKI GCWGC 1 cut(s) 147
AspS9I GGNCC 1 cut(s) 121
AvaII GGWCC 1 cut(s) 121
BaeGI GKGCMC 1 cut(s) 71
Bbv12I GWGCWC 1 cut(s) 71
BbvI GCAGC 1 cut(s) 134
BccI CCATC 1 cut(s) 37
BciT130I CCWGG 2 cut(s) 36, 126
BfaI CTAG 1 cut(s) 178
BisI GCNGC 1 cut(s) 148
BlsI GCNGC 1 cut(s) 149
Bme1390I CCNGG 2 cut(s) 36, 126
Bme18I GGWCC 1 cut(s) 121
BmgT120I GGNCC 1 cut(s) 121
BmiI GGNNCC 1 cut(s) 123
BmrFI CCNGG 2 cut(s) 36, 126
BplI GAGNNNNNCTC 2 cut(s) 120, 152
BsaJI CCNNGG 1 cut(s) 124
Bse1I ACTGG 1 cut(s) 75
BseBI CCWGG 2 cut(s) 36, 126
BseDI CCNNGG 1 cut(s) 124
BseGI GGATG 1 cut(s) 52
BseNI ACTGG 1 cut(s) 75
BseSI GKGCMC 1 cut(s) 71
BseXI GCAGC 1 cut(s) 134
BsiHKAI GWGCWC 1 cut(s) 71
Bsp1286I GDGCHC 1 cut(s) 71
BspLI GGNNCC 1 cut(s) 123
BsrI ACTGG 1 cut(s) 75
BssECI CCNNGG 1 cut(s) 124
Bst2UI CCWGG 2 cut(s) 36, 126
BstDEI CTNAG 2 cut(s) 20, 63
BstF5I GGATG 1 cut(s) 52
BstNI CCWGG 2 cut(s) 36, 126
BstSCI CCNGG 2 cut(s) 34, 124
BstSLI GKGCMC 1 cut(s) 71
BstV1I GCAGC 1 cut(s) 134
BtsCI GGATG 1 cut(s) 52
CaiI CAGNNNCTG 1 cut(s) 131
Cfr13I GGNCC 1 cut(s) 121
CsiI ACCWGGT 1 cut(s) 34
Csp6I GTAC 1 cut(s) 95
CspCI CAANNNNNGTGG 2 cut(s) 21, 56
CviJI RGCY 5 cut(s) 8, 104, 117, 131, 147
CviKI_1 RGCY 5 cut(s) 8, 104, 117, 131, 147
CviQI GTAC 1 cut(s) 95
DdeI CTNAG 2 cut(s) 20, 63
Eco47I GGWCC 1 cut(s) 121
EcoRII CCWGG 2 cut(s) 34, 124
FaiI YATR 2 cut(s) 161, 166
Fnu4HI GCNGC 1 cut(s) 148
FokI GGATG 1 cut(s) 59
Fsp4HI GCNGC 1 cut(s) 148
FspBI CTAG 1 cut(s) 178
GluI GCNGC 1 cut(s) 148
Hpy166II GTNNAC 2 cut(s) 69, 80
Hpy8I GTNNAC 2 cut(s) 69, 80
HpyCH4V TGCA 1 cut(s) 69
HpyF3I CTNAG 2 cut(s) 20, 63
LmnI GCTCC 1 cut(s) 128
LpnPI CCDG 6 cut(s) 21, 48, 88, 96, 111, 138
Lsp1109I GCAGC 1 cut(s) 134
MabI ACCWGGT 1 cut(s) 34
MaeI CTAG 1 cut(s) 178
MboII GAAGA 1 cut(s) 46
MhlI GDGCHC 1 cut(s) 71
MluCI AATT 2 cut(s) 13, 26
MnlI CCTC 1 cut(s) 146
MspR9I CCNGG 2 cut(s) 36, 126
MvaI CCWGG 2 cut(s) 36, 126
NlaIV GGNNCC 1 cut(s) 123
PkrI GCNGC 1 cut(s) 149
Psp6I CCWGG 2 cut(s) 34, 124
PspGI CCWGG 2 cut(s) 34, 124
PspN4I GGNNCC 1 cut(s) 123
PspPI GGNCC 1 cut(s) 121
PstNI CAGNNNCTG 1 cut(s) 131
RsaI GTAC 1 cut(s) 96
RsaNI GTAC 1 cut(s) 95
SatI GCNGC 1 cut(s) 148
Sau96I GGNCC 1 cut(s) 121
ScrFI CCNGG 2 cut(s) 36, 126
SduI GDGCHC 1 cut(s) 71
SetI ASST 5 cut(s) 37, 85, 106, 133, 149
SexAI ACCWGGT 1 cut(s) 34
SgeI CNNG 9 cut(s) 47, 48, 87, 95, 104, 130, 137, 138, 149
SinI GGWCC 1 cut(s) 121
Sse9I AATT 2 cut(s) 13, 26
SspMI CTAG 1 cut(s) 178
StyD4I CCNGG 2 cut(s) 34, 124
TaqI TCGA 1 cut(s) 138
TasI AATT 2 cut(s) 13, 26
TseI GCWGC 1 cut(s) 147
VneI GTGCAC 1 cut(s) 67
VpaK11BI GGWCC 1 cut(s) 121
XspI CTAG 1 cut(s) 178
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.