RchiOBHm_Chr2g0149921

RING-box protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Reverse (-)
67738174 .. 67738437
264 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 264 bp
ATGTGGGCGTGGGATTTTGTGGTGGATAACTGCGCCATCTGCAGGAACCATATAATGCACCTGTGCATAGAGTGCCAAGCCAACCAGAAAACTGTGACCAACGAAGAATGTATGGTGGCTTGGGAACTTGCAACCATGCCTTCCACTTCCACTGCATTAGTTGATGCCTCAAGACTCGTCAGGTCTGTCCTTTGGATAACAGCGAGTGGGAGTTCCAGAAGTATGGTCATGATTAAAACCATGCATGTCAAAACCAGGCTCTAA

Protein Analysis

87

Amino Acids

9.86

Weight (kDa)

7.67

Isoelectric Point (pI)

66.77

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
zf-rbx1 PF12678 9 - 41 6.9e-07 RING-H2 zinc finger domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0029890)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr2g0149921
rosa_rugosa Rorug02G0415100

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfiI CCNNNNNNNGG 1 cut(s) 42
AjnI CCWGG 1 cut(s) 254
AspLEI GCGC 1 cut(s) 35
BccI CCATC 1 cut(s) 44
BciT130I CCWGG 1 cut(s) 256
BfmI CTRYAG 1 cut(s) 40
Bme1390I CCNGG 1 cut(s) 256
BmiI GGNNCC 1 cut(s) 47
BmrFI CCNGG 1 cut(s) 256
BmsI GCATC 1 cut(s) 154
BpuEI CTTGAG 1 cut(s) 154
Bsc4I CCNNNNNNNGG 1 cut(s) 42
BseBI CCWGG 1 cut(s) 256
BseLI CCNNNNNNNGG 1 cut(s) 42
BslI CCNNNNNNNGG 1 cut(s) 42
BspHI TCATGA 1 cut(s) 228
BspLI GGNNCC 1 cut(s) 47
BspMAI CTGCAG 1 cut(s) 44
Bst2UI CCWGG 1 cut(s) 256
Bst4CI ACNGT 1 cut(s) 94
BstAPI GCANNNNNTGC 1 cut(s) 72
BstHHI GCGC 1 cut(s) 35
BstMWI GCNNNNNNNGC 2 cut(s) 39, 72
BstNI CCWGG 1 cut(s) 256
BstNSI RCATGY 1 cut(s) 248
BstSCI CCNGG 1 cut(s) 254
BstSFI CTRYAG 1 cut(s) 40
BstXI CCANNNNNNTGG 1 cut(s) 223
BtsI GCAGTG 1 cut(s) 150
BtsIMutI CAGTG 1 cut(s) 150
CciI TCATGA 1 cut(s) 228
CfoI GCGC 1 cut(s) 35
CviAII CATG 4 cut(s) 136, 229, 241, 245
CviJI RGCY 3 cut(s) 80, 119, 259
CviKI_1 RGCY 3 cut(s) 80, 119, 259
EcoRII CCWGG 1 cut(s) 254
EcoT22I ATGCAT 1 cut(s) 246
FaeI CATG 4 cut(s) 139, 232, 244, 248
FaiI YATR 9 cut(s) 51, 53, 68, 113, 137, 224, 230, 242, 246
FatI CATG 4 cut(s) 135, 228, 240, 244
GlaI GCGC 1 cut(s) 34
HhaI GCGC 1 cut(s) 35
Hin1II CATG 4 cut(s) 139, 232, 244, 248
Hin6I GCGC 1 cut(s) 33
HinP1I GCGC 1 cut(s) 33
HinfI GANTC 1 cut(s) 174
Hpy188III TCNNGA 3 cut(s) 171, 216, 229
HpyAV CCTTC 1 cut(s) 150
HpyCH4III ACNGT 1 cut(s) 94
HpyCH4V TGCA 6 cut(s) 42, 58, 66, 131, 155, 244
HpyF10VI GCNNNNNNNGC 2 cut(s) 39, 72
Hsp92II CATG 4 cut(s) 139, 232, 244, 248
HspAI GCGC 1 cut(s) 33
LpnPI CCDG 6 cut(s) 28, 74, 98, 166, 229, 241
LweI GCATC 1 cut(s) 154
MaeIII GTNAC 1 cut(s) 94
MboII GAAGA 1 cut(s) 116
MlyI GAGTC 1 cut(s) 168
MnlI CCTC 1 cut(s) 178
Mph1103I ATGCAT 1 cut(s) 246
MseI TTAA 1 cut(s) 234
MspR9I CCNGG 1 cut(s) 256
MvaI CCWGG 1 cut(s) 256
MwoI GCNNNNNNNGC 2 cut(s) 39, 72
NlaIII CATG 4 cut(s) 139, 232, 244, 248
NlaIV GGNNCC 1 cut(s) 47
NmuCI GTSAC 1 cut(s) 94
NsiI ATGCAT 1 cut(s) 246
NspI RCATGY 1 cut(s) 248
PagI TCATGA 1 cut(s) 228
PleI GAGTC 1 cut(s) 168
PpsI GAGTC 1 cut(s) 168
Psp6I CCWGG 1 cut(s) 254
PspGI CCWGG 1 cut(s) 254
PspN4I GGNNCC 1 cut(s) 47
PstI CTGCAG 1 cut(s) 44
SaqAI TTAA 1 cut(s) 234
SchI GAGTC 1 cut(s) 168
ScrFI CCNGG 1 cut(s) 256
SetI ASST 2 cut(s) 63, 185
SfaNI GCATC 1 cut(s) 154
SfcI CTRYAG 1 cut(s) 40
SmlI CTYRAG 1 cut(s) 169
SmoI CTYRAG 1 cut(s) 169
StyD4I CCNGG 1 cut(s) 254
TaaI ACNGT 1 cut(s) 94
Tru1I TTAA 1 cut(s) 234
Tru9I TTAA 1 cut(s) 234
TscAI CASTG 1 cut(s) 157
TseFI GTSAC 1 cut(s) 94
Tsp45I GTSAC 1 cut(s) 94
TspRI CASTG 1 cut(s) 157
XceI RCATGY 1 cut(s) 248
Zsp2I ATGCAT 1 cut(s) 246
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.