RchiOBHm_Chr2g0150091

Belongs to the short-chain dehydrogenases reductases (SDR) family

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Reverse (-)
67870724 .. 67871036
313 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 165 bp
ATGCAGGACGGTGTAGAAGTCAACTTGAGTAGACTAATCACTCAAACATATAAGTTAGCTGAAGAATGTGTGAAAACAAACTACTATGGTCCAATTACAAGCTGTTTAGTTGCATGTAATCTTAATTACCTGGCATTTTTCATTTGCTATCTTGTATGTAGGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

54

Amino Acids

6.19

Weight (kDa)

6.0

Isoelectric Point (pI)

40.5

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0022681)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr2g0150091
rosa_samantha Rh2BG490200 Rh2CG463700 Rh2DG498900

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 31
AcuI CTGAAG 1 cut(s) 81
AjnI CCWGG 1 cut(s) 129
AluBI AGCT 2 cut(s) 59, 102
AluI AGCT 2 cut(s) 59, 102
AspS9I GGNCC 1 cut(s) 89
AvaII GGWCC 1 cut(s) 89
BciT130I CCWGG 1 cut(s) 131
Bme1390I CCNGG 1 cut(s) 131
Bme18I GGWCC 1 cut(s) 89
BmgT120I GGNCC 1 cut(s) 89
BmrFI CCNGG 1 cut(s) 131
BpuEI CTTGAG 1 cut(s) 46
BseBI CCWGG 1 cut(s) 131
Bst2UI CCWGG 1 cut(s) 131
Bst4CI ACNGT 1 cut(s) 11
BstNI CCWGG 1 cut(s) 131
BstNSI RCATGY 1 cut(s) 117
BstSCI CCNGG 1 cut(s) 129
Cfr13I GGNCC 1 cut(s) 89
CviAII CATG 1 cut(s) 114
CviJI RGCY 2 cut(s) 59, 102
CviKI_1 RGCY 2 cut(s) 59, 102
Eco47I GGWCC 1 cut(s) 89
Eco57I CTGAAG 1 cut(s) 81
EcoRII CCWGG 1 cut(s) 129
FaeI CATG 1 cut(s) 117
FaiI YATR 5 cut(s) 49, 51, 87, 115, 157
FatI CATG 1 cut(s) 113
FblI GTMKAC 1 cut(s) 31
FspEI CC 5 cut(s) 72, 105, 116, 143, 145
Hin1II CATG 1 cut(s) 117
HincII GTYRAC 1 cut(s) 22
HindII GTYRAC 1 cut(s) 22
Hpy166II GTNNAC 2 cut(s) 22, 32
Hpy8I GTNNAC 2 cut(s) 22, 32
HpyCH4III ACNGT 1 cut(s) 11
HpyCH4V TGCA 2 cut(s) 4, 113
Hsp92II CATG 1 cut(s) 117
LpnPI CCDG 2 cut(s) 116, 143
MboII GAAGA 1 cut(s) 74
MluCI AATT 2 cut(s) 93, 124
MseI TTAA 1 cut(s) 123
MspR9I CCNGG 1 cut(s) 131
MvaI CCWGG 1 cut(s) 131
NlaIII CATG 1 cut(s) 117
NspI RCATGY 1 cut(s) 117
Psp6I CCWGG 1 cut(s) 129
PspGI CCWGG 1 cut(s) 129
PspPI GGNCC 1 cut(s) 89
SaqAI TTAA 1 cut(s) 123
Sau96I GGNCC 1 cut(s) 89
ScrFI CCNGG 1 cut(s) 131
SetI ASST 4 cut(s) 61, 104, 132, 164
SgeI CNNG 6 cut(s) 17, 37, 111, 126, 142, 143
SinI GGWCC 1 cut(s) 89
SmlI CTYRAG 1 cut(s) 25
SmoI CTYRAG 1 cut(s) 25
Sse9I AATT 2 cut(s) 93, 124
StyD4I CCNGG 1 cut(s) 129
TaaI ACNGT 1 cut(s) 11
TasI AATT 2 cut(s) 93, 124
Tru1I TTAA 1 cut(s) 123
Tru9I TTAA 1 cut(s) 123
TspDTI ATGAA 1 cut(s) 130
VpaK11BI GGWCC 1 cut(s) 89
XceI RCATGY 1 cut(s) 117
XmiI GTMKAC 1 cut(s) 31
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.