RchiOBHm_Chr2g0155071

PAN-like domain

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Reverse (-)
72090642 .. 72091332
691 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 429 bp
ATGATATTGATCTATGAGTACATGTCTAATCGAAGTTTGGACAAATTTGTTGTTTGGTATATTGGGATACGTACATGCTTTCGAATTATACAAGGTATTGCTCAAGGAGTACTATATATCCACAAGTACTCTAGATTGAAAATTATTCATAGAGATCTAAAAGCAAGTAATTTTCTGTTGGATGGAACAATGAACCCCAAAGTGTCTGACTTTGGAATGGCGAGAATTTTTGACATAAATCAAATTGAAGCAAATACCAACAAGGTTGTTGGGACATACGGCTACATGTCTCCTGAATATGCACTCTATGGTCATTTCTCTGAGAAGTTGGATGTATTTAGTTTTGGAATATTGTTGTTAGAGATTATAAGTGGAAAGAAGAATGCTTCATTTTATTATTTTGAAAATTCACTAACACTTGCTCAATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.

Protein Analysis

142

Amino Acids

16.44

Weight (kDa)

8.93

Isoelectric Point (pI)

35.83

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Pkinase PF00069 1 - 127 1.7e-27 Protein kinase domain
PK_Tyr_Ser-Thr PF07714 2 - 127 5.3e-24 Protein tyrosine and serine/threonine kinase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0029832)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr2g0155071
rosa_rugosa Rorug05G0516500

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 368
AcsI RAATTY 3 cut(s) 44, 225, 406
AfaI GTAC 4 cut(s) 20, 73, 111, 128
AflIII ACRYGT 2 cut(s) 21, 285
AgsI TTSAA 3 cut(s) 139, 248, 404
Alw26I GTCTC 1 cut(s) 294
ApoI RAATTY 3 cut(s) 44, 225, 406
AsuII TTCGAA 1 cut(s) 82
BccI CCATC 1 cut(s) 176
BceAI ACGGC 1 cut(s) 295
BciVI GTATCC 1 cut(s) 60
BcoDI GTCTC 1 cut(s) 294
BfaI CTAG 1 cut(s) 132
BfuI GTATCC 1 cut(s) 60
BglII AGATCT 1 cut(s) 154
BmcAI AGTACT 2 cut(s) 111, 128
Bpu14I TTCGAA 1 cut(s) 82
BpuEI CTTGAG 1 cut(s) 87
BsaAI YACGTR 1 cut(s) 71
BsaBI GATNNNNATC 1 cut(s) 8
Bse8I GATNNNNATC 1 cut(s) 8
BseGI GGATG 2 cut(s) 187, 337
BseJI GATNNNNATC 1 cut(s) 8
BseMII CTCAG 1 cut(s) 312
BslFI GGGAC 1 cut(s) 286
BsmAI GTCTC 1 cut(s) 294
BsmFI GGGAC 1 cut(s) 286
BsmI GAATGC 1 cut(s) 388
Bsp119I TTCGAA 1 cut(s) 82
Bsp143I GATC 2 cut(s) 9, 154
BspCNI CTCAG 1 cut(s) 313
BspT104I TTCGAA 1 cut(s) 82
BssMI GATC 2 cut(s) 9, 154
BstBAI YACGTR 1 cut(s) 71
BstBI TTCGAA 1 cut(s) 82
BstDEI CTNAG 1 cut(s) 321
BstF5I GGATG 2 cut(s) 187, 337
BstKTI GATC 2 cut(s) 12, 157
BstMAI GTCTC 1 cut(s) 294
BstMBI GATC 2 cut(s) 9, 154
BstNSI RCATGY 3 cut(s) 25, 78, 289
BstSNI TACGTA 1 cut(s) 71
BstX2I RGATCY 1 cut(s) 154
BstYI RGATCY 1 cut(s) 154
BsuI GTATCC 1 cut(s) 60
BtsCI GGATG 2 cut(s) 187, 337
Csp6I GTAC 4 cut(s) 19, 72, 110, 127
CviAII CATG 3 cut(s) 22, 75, 286
CviJI RGCY 1 cut(s) 282
CviKI_1 RGCY 1 cut(s) 282
CviQI GTAC 4 cut(s) 19, 72, 110, 127
DdeI CTNAG 1 cut(s) 321
DpnI GATC 2 cut(s) 11, 156
DpnII GATC 2 cut(s) 9, 154
Eco105I TACGTA 1 cut(s) 71
FaeI CATG 3 cut(s) 25, 78, 289
FaqI GGGAC 1 cut(s) 286
FatI CATG 3 cut(s) 21, 74, 285
FokI GGATG 2 cut(s) 194, 344
FspBI CTAG 1 cut(s) 132
Hin1II CATG 3 cut(s) 25, 78, 289
Hpy188I TCNGA 2 cut(s) 208, 322
Hpy188III TCNNGA 2 cut(s) 132, 293
HpyCH4IV ACGT 1 cut(s) 70
HpyCH4V TGCA 1 cut(s) 302
HpyF3I CTNAG 1 cut(s) 321
HpySE526I ACGT 1 cut(s) 70
Hsp92II CATG 3 cut(s) 25, 78, 289
Kzo9I GATC 2 cut(s) 9, 154
LpnPI CCDG 1 cut(s) 306
MaeI CTAG 1 cut(s) 132
MaeII ACGT 1 cut(s) 70
MalI GATC 2 cut(s) 11, 156
MboI GATC 2 cut(s) 9, 154
MboII GAAGA 1 cut(s) 391
MflI RGATCY 1 cut(s) 154
MluCI AATT 7 cut(s) 44, 84, 141, 169, 225, 243, 406
MmeI TCCRAC 2 cut(s) 159, 309
Mva1269I GAATGC 1 cut(s) 388
NdeII GATC 2 cut(s) 9, 154
NlaIII CATG 3 cut(s) 25, 78, 289
NspI RCATGY 3 cut(s) 25, 78, 289
NspV TTCGAA 1 cut(s) 82
PciI ACATGT 2 cut(s) 21, 285
PctI GAATGC 1 cut(s) 388
Ppu21I YACGTR 1 cut(s) 71
PscI ACATGT 2 cut(s) 21, 285
PsiI TTATAA 1 cut(s) 368
PsuI RGATCY 1 cut(s) 154
RsaI GTAC 4 cut(s) 20, 73, 111, 128
RsaNI GTAC 4 cut(s) 19, 72, 110, 127
Sau3AI GATC 2 cut(s) 9, 154
ScaI AGTACT 2 cut(s) 111, 128
SetI ASST 3 cut(s) 73, 97, 267
SfuI TTCGAA 1 cut(s) 82
SmlI CTYRAG 1 cut(s) 102
SmoI CTYRAG 1 cut(s) 102
SnaBI TACGTA 1 cut(s) 71
Sse9I AATT 7 cut(s) 44, 84, 141, 169, 225, 243, 406
SspI AATATT 1 cut(s) 351
SspMI CTAG 1 cut(s) 132
TaiI ACGT 1 cut(s) 73
TaqI TCGA 2 cut(s) 31, 82
TasI AATT 7 cut(s) 44, 84, 141, 169, 225, 243, 406
TatI WGTACW 3 cut(s) 18, 109, 126
TspDTI ATGAA 3 cut(s) 137, 206, 378
XapI RAATTY 3 cut(s) 44, 225, 406
XbaI TCTAGA 1 cut(s) 131
XceI RCATGY 3 cut(s) 25, 78, 289
XspI CTAG 1 cut(s) 132
ZrmI AGTACT 2 cut(s) 111, 128
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.