RchiOBHm_Chr2g0156931

Catalyzes the ATP-dependent amination of UTP to CTP with either L-glutamine or ammonia as the source of nitrogen

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
OG0029729
Physical Location & Seq
Forward (+)
73442357 .. 73443539
1183 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 162 bp
ATGGGTGTTGAGTGGGTTGGGCAGAGGCACCATAGGCATCGTTCTCAAGCTTGTGACCTTCACGTCACCTGCATCAAAATCGATCTGAAGTTGAATACAAATGGTGGTACTATGTCTCCCTTTGATTATGGTATTGTTTTCGTTCTTGATGGTGGTGCATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00240 ko01100 map00240 map01100
Pfam Domains
Protein Families
CTP_synth_N GATase

Protein Analysis

53

Amino Acids

5.88

Weight (kDa)

6.89

Isoelectric Point (pI)

38.8

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
CTP_synth_N PF06418 16 - 53 2.6e-07 CTP synthase N-terminus
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0029729)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr2g0156931
rosa_roxburghii Rroxscaffold_5G00333640

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AarI CACCTGC 1 cut(s) 77
AasI GACNNNNNNGTC 1 cut(s) 62
Acc36I ACCTGC 1 cut(s) 77
AccB1I GGYRCC 1 cut(s) 27
AcuI CTGAAG 1 cut(s) 107
AfaI GTAC 1 cut(s) 109
AgsI TTSAA 1 cut(s) 94
AjiI CACGTC 1 cut(s) 64
AluBI AGCT 1 cut(s) 50
AluI AGCT 1 cut(s) 50
Alw26I GTCTC 1 cut(s) 120
AsuHPI GGTGA 1 cut(s) 58
BanI GGYRCC 1 cut(s) 27
BccI CCATC 1 cut(s) 143
BcgI CGANNNNNNTGC 2 cut(s) 61, 95
BcoDI GTCTC 1 cut(s) 120
BfuAI ACCTGC 1 cut(s) 77
BmgBI CACGTC 1 cut(s) 64
BmiI GGNNCC 1 cut(s) 29
BmsI GCATC 2 cut(s) 46, 81
BpuEI CTTGAG 1 cut(s) 30
Bsa29I ATCGAT 1 cut(s) 81
BsaXI ACNNNNNCTCC 2 cut(s) 100, 130
BseCI ATCGAT 1 cut(s) 81
BshNI GGYRCC 1 cut(s) 27
BshVI ATCGAT 1 cut(s) 81
BsmAI GTCTC 1 cut(s) 120
Bsp143I GATC 1 cut(s) 82
BspDI ATCGAT 1 cut(s) 81
BspLI GGNNCC 1 cut(s) 29
BspMI ACCTGC 1 cut(s) 77
BspT107I GGYRCC 1 cut(s) 27
BssMI GATC 1 cut(s) 82
BstKTI GATC 1 cut(s) 85
BstMAI GTCTC 1 cut(s) 120
BstMBI GATC 1 cut(s) 82
BstMWI GCNNNNNNNGC 1 cut(s) 34
Bsu15I ATCGAT 1 cut(s) 81
BsuTUI ATCGAT 1 cut(s) 81
BtrI CACGTC 1 cut(s) 64
BveI ACCTGC 1 cut(s) 77
ClaI ATCGAT 1 cut(s) 81
Csp6I GTAC 1 cut(s) 108
CviJI RGCY 1 cut(s) 50
CviKI_1 RGCY 1 cut(s) 50
CviQI GTAC 1 cut(s) 108
DpnI GATC 1 cut(s) 84
DpnII GATC 1 cut(s) 82
DrdI GACNNNNNNGTC 1 cut(s) 62
DseDI GACNNNNNNGTC 1 cut(s) 62
Eco57I CTGAAG 1 cut(s) 107
FaiI YATR 4 cut(s) 33, 113, 129, 160
HindIII AAGCTT 1 cut(s) 48
HphI GGTGA 1 cut(s) 58
Hpy188I TCNGA 1 cut(s) 87
Hpy188III TCNNGA 1 cut(s) 146
HpyAV CCTTC 1 cut(s) 68
HpyCH4IV ACGT 1 cut(s) 63
HpyCH4V TGCA 2 cut(s) 72, 158
HpyF10VI GCNNNNNNNGC 1 cut(s) 34
HpySE526I ACGT 1 cut(s) 63
Kzo9I GATC 1 cut(s) 82
LpnPI CCDG 1 cut(s) 82
LweI GCATC 2 cut(s) 46, 81
MaeII ACGT 1 cut(s) 63
MaeIII GTNAC 2 cut(s) 53, 64
MalI GATC 1 cut(s) 84
MboI GATC 1 cut(s) 82
MnlI CCTC 1 cut(s) 18
MwoI GCNNNNNNNGC 1 cut(s) 34
NdeII GATC 1 cut(s) 82
NlaIV GGNNCC 1 cut(s) 29
NmuCI GTSAC 2 cut(s) 53, 64
PaqCI CACCTGC 1 cut(s) 77
PspN4I GGNNCC 1 cut(s) 29
RsaI GTAC 1 cut(s) 109
RsaNI GTAC 1 cut(s) 108
Sau3AI GATC 1 cut(s) 82
SetI ASST 4 cut(s) 52, 60, 66, 71
SfaNI GCATC 2 cut(s) 46, 81
SgeI CNNG 5 cut(s) 59, 63, 74, 81, 158
SmlI CTYRAG 1 cut(s) 45
SmoI CTYRAG 1 cut(s) 45
TaiI ACGT 1 cut(s) 66
TaqI TCGA 1 cut(s) 81
TseFI GTSAC 2 cut(s) 53, 64
Tsp45I GTSAC 2 cut(s) 53, 64
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.