Basic Information

Type: gene

Biological Identity

Species

rosa_roxburghii

Chromosome

GWHEROQ00000005

Orthogroup ID

OG0029729

Physical Location & Seq

Genomic Coordinates Reverse (-)

1060548 .. 1063188

Gene Structure 2641 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rroxscaffold_5G00333640.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 162 bp

ATGGGTGTTGAGTGGGCTGGGCAGAGGCACCATAGGCATCGTTCTCAAGCGTGTGACCTTCACGTCACCTGCATCAAAATTGATCTGAAGTTGAATACAAATGGTGGTACTATGTCTCCCTTTGATTATGGTATGGTTTTCGTTCTTGATGGTGGTGCATAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

ko00240 ko01100 map00240 map01100

Pfam Domains

Protein Families

CTP_synth_N GATase

Protein Analysis

53

Amino Acids

5.87

Weight (kDa)

6.89

Isoelectric Point (pI)

42.37

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
CTP_synth_N	PF06418	16 - 53	1.8e-07	CTP synthase N-terminus

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0029729)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr2g0156931
rosa_roxburghii	Rroxscaffold_5G00333640

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AarI	CACCTGC	1 cut(s)	77
AasI	GACNNNNNNGTC	1 cut(s)	62
Acc36I	ACCTGC	1 cut(s)	77
AccB1I	GGYRCC	1 cut(s)	27
AcuI	CTGAAG	1 cut(s)	107
AfaI	GTAC	1 cut(s)	109
AgsI	TTSAA	1 cut(s)	94
AjiI	CACGTC	1 cut(s)	64
Alw26I	GTCTC	1 cut(s)	120
AsuHPI	GGTGA	1 cut(s)	58
BanI	GGYRCC	1 cut(s)	27
BccI	CCATC	1 cut(s)	143
BcoDI	GTCTC	1 cut(s)	120
BfuAI	ACCTGC	1 cut(s)	77
BmgBI	CACGTC	1 cut(s)	64
BmiI	GGNNCC	1 cut(s)	29
BmsI	GCATC	2 cut(s)	46, 81
BpuEI	CTTGAG	1 cut(s)	30
BsaXI	ACNNNNNCTCC	2 cut(s)	100, 130
BseYI	CCCAGC	1 cut(s)	17
BshNI	GGYRCC	1 cut(s)	27
BsmAI	GTCTC	1 cut(s)	120
Bsp143I	GATC	1 cut(s)	82
BspLI	GGNNCC	1 cut(s)	29
BspMI	ACCTGC	1 cut(s)	77
BspT107I	GGYRCC	1 cut(s)	27
BssMI	GATC	1 cut(s)	82
BstKTI	GATC	1 cut(s)	85
BstMAI	GTCTC	1 cut(s)	120
BstMBI	GATC	1 cut(s)	82
BstMWI	GCNNNNNNNGC	1 cut(s)	34
BtrI	CACGTC	1 cut(s)	64
BveI	ACCTGC	1 cut(s)	77
Csp6I	GTAC	1 cut(s)	108
CviJI	RGCY	1 cut(s)	17
CviKI_1	RGCY	1 cut(s)	17
CviQI	GTAC	1 cut(s)	108
DpnI	GATC	1 cut(s)	84
DpnII	GATC	1 cut(s)	82
DrdI	GACNNNNNNGTC	1 cut(s)	62
DseDI	GACNNNNNNGTC	1 cut(s)	62
Eco57I	CTGAAG	1 cut(s)	107
FaiI	YATR	5 cut(s)	33, 113, 129, 134, 160
GsaI	CCCAGC	1 cut(s)	21
HphI	GGTGA	1 cut(s)	58
Hpy188I	TCNGA	1 cut(s)	87
Hpy188III	TCNNGA	1 cut(s)	146
HpyAV	CCTTC	1 cut(s)	68
HpyCH4IV	ACGT	1 cut(s)	63
HpyCH4V	TGCA	2 cut(s)	72, 158
HpyF10VI	GCNNNNNNNGC	1 cut(s)	34
HpySE526I	ACGT	1 cut(s)	63
Kzo9I	GATC	1 cut(s)	82
LpnPI	CCDG	2 cut(s)	3, 82
LweI	GCATC	2 cut(s)	46, 81
MaeII	ACGT	1 cut(s)	63
MaeIII	GTNAC	2 cut(s)	53, 64
MalI	GATC	1 cut(s)	84
MboI	GATC	1 cut(s)	82
MluCI	AATT	1 cut(s)	78
MnlI	CCTC	1 cut(s)	18
MwoI	GCNNNNNNNGC	1 cut(s)	34
NdeII	GATC	1 cut(s)	82
NlaIV	GGNNCC	1 cut(s)	29
NmuCI	GTSAC	2 cut(s)	53, 64
PaqCI	CACCTGC	1 cut(s)	77
PspFI	CCCAGC	1 cut(s)	17
PspN4I	GGNNCC	1 cut(s)	29
RsaI	GTAC	1 cut(s)	109
RsaNI	GTAC	1 cut(s)	108
Sau3AI	GATC	1 cut(s)	82
SetI	ASST	3 cut(s)	60, 66, 71
SfaNI	GCATC	2 cut(s)	46, 81
SgeI	CNNG	6 cut(s)	30, 59, 63, 74, 81, 158
SmlI	CTYRAG	1 cut(s)	45
SmoI	CTYRAG	1 cut(s)	45
Sse9I	AATT	1 cut(s)	78
TaiI	ACGT	1 cut(s)	66
TasI	AATT	1 cut(s)	78
TseFI	GTSAC	2 cut(s)	53, 64
Tsp45I	GTSAC	2 cut(s)	53, 64

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.