RchiOBHm_Chr2g0157351

Belongs to the class-I aminoacyl-tRNA synthetase family

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Forward (+)
73757628 .. 73759554
1927 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 150 bp
ATGAAATCATTTAAGCGTTATGGAATATTTGCAGATTGGAGTAATCCCTACTTGACTCTTGATCCAAAATATAAAGCTTGTTTCTCTGGGTGGAAAGATCTATTAGGTCCATCATGGAATTTCAGACATGAGTCCATAATCACAAGGTGA

Protein Analysis

49

Amino Acids

5.87

Weight (kDa)

9.58

Isoelectric Point (pI)

28.79

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0022645)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr2g0157351 RchiOBHm_Chr2g0162141 RchiOBHm_Chr5g0058951
rosa_samantha Rh2BG538900

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 56
AcsI RAATTY 1 cut(s) 118
AdeI CACNNNGTG 1 cut(s) 147
AluBI AGCT 1 cut(s) 77
AluI AGCT 1 cut(s) 77
AlwI GGATC 1 cut(s) 56
ApoI RAATTY 1 cut(s) 118
AspS9I GGNCC 1 cut(s) 107
AvaII GGWCC 1 cut(s) 107
BccI CCATC 1 cut(s) 118
BglII AGATCT 1 cut(s) 97
Bme18I GGWCC 1 cut(s) 107
BmgT120I GGNCC 1 cut(s) 107
BoxI GACNNNNGTC 1 cut(s) 130
Bsp143I GATC 2 cut(s) 61, 97
BspPI GGATC 1 cut(s) 56
BssMI GATC 2 cut(s) 61, 97
BstKTI GATC 2 cut(s) 64, 100
BstMBI GATC 2 cut(s) 61, 97
BstPAI GACNNNNGTC 1 cut(s) 130
BstX2I RGATCY 1 cut(s) 97
BstYI RGATCY 1 cut(s) 97
Cfr13I GGNCC 1 cut(s) 107
CviAII CATG 2 cut(s) 114, 128
CviJI RGCY 1 cut(s) 77
CviKI_1 RGCY 1 cut(s) 77
DpnI GATC 2 cut(s) 63, 99
DpnII GATC 2 cut(s) 61, 97
DraIII CACNNNGTG 1 cut(s) 147
Eco47I GGWCC 1 cut(s) 107
FaeI CATG 2 cut(s) 117, 131
FaiI YATR 5 cut(s) 21, 72, 115, 129, 137
FatI CATG 2 cut(s) 113, 127
Hin1II CATG 2 cut(s) 117, 131
HindIII AAGCTT 1 cut(s) 75
HinfI GANTC 2 cut(s) 55, 131
Hpy188I TCNGA 1 cut(s) 125
Hpy188III TCNNGA 1 cut(s) 59
HpyCH4V TGCA 1 cut(s) 32
Hsp92II CATG 2 cut(s) 117, 131
Kzo9I GATC 2 cut(s) 61, 97
LpnPI CCDG 1 cut(s) 72
MalI GATC 2 cut(s) 63, 99
MboI GATC 2 cut(s) 61, 97
MflI RGATCY 1 cut(s) 97
MluCI AATT 1 cut(s) 118
MlyI GAGTC 2 cut(s) 49, 140
MseI TTAA 1 cut(s) 12
NdeII GATC 2 cut(s) 61, 97
NlaIII CATG 2 cut(s) 117, 131
PleI GAGTC 2 cut(s) 49, 139
PpsI GAGTC 2 cut(s) 49, 139
PshAI GACNNNNGTC 1 cut(s) 130
PspPI GGNCC 1 cut(s) 107
PsuI RGATCY 1 cut(s) 97
SaqAI TTAA 1 cut(s) 12
Sau3AI GATC 2 cut(s) 61, 97
Sau96I GGNCC 1 cut(s) 107
SchI GAGTC 2 cut(s) 49, 140
SetI ASST 3 cut(s) 79, 109, 149
SgeI CNNG 6 cut(s) 64, 71, 90, 99, 126, 140
SinI GGWCC 1 cut(s) 107
Sse9I AATT 1 cut(s) 118
SspI AATATT 1 cut(s) 27
TasI AATT 1 cut(s) 118
Tru1I TTAA 1 cut(s) 12
Tru9I TTAA 1 cut(s) 12
TspDTI ATGAA 1 cut(s) 17
VpaK11BI GGWCC 1 cut(s) 107
XapI RAATTY 1 cut(s) 118
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.