RchiOBHm_Chr2g0160881

PAN-like domain

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Reverse (-)
76790064 .. 76790291
228 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 228 bp
ATGGCTTTTTATTGGGTCATTTTTTTTCTTCATCTACAGGGGATTTTGCCTGAAAATCAAGAAGTAGCCATAAAAAGGCTATCAAAGTTGTCTAGGCAAGGGCATCAGGAGTTCATAAATGAGATCAAGCTTATAGCCAAACTCCAGCACACCAATCTTGTTAGACTCTTGGGTTGTTGTGTTGAAGAGGAGGAAATGATATTAATCTATGAGTTCATGCCCAATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.

Protein Analysis

75

Amino Acids

8.92

Weight (kDa)

5.85

Isoelectric Point (pI)

55.33

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PK_Tyr_Ser-Thr PF07714 18 - 74 1.6e-12 Protein tyrosine and serine/threonine kinase
Pkinase PF00069 18 - 74 1.4e-09 Protein kinase domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0029359)

Species Orthologous Gene IDs
pyrus_communis pycom09g02470
rosa_chinensis RchiOBHm_Chr2g0160881

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfiI CCNNNNNNNGG 1 cut(s) 75
AgsI TTSAA 1 cut(s) 185
AluBI AGCT 1 cut(s) 130
AluI AGCT 1 cut(s) 130
AseI ATTAAT 1 cut(s) 203
BfaI CTAG 1 cut(s) 93
BfmI CTRYAG 1 cut(s) 35
BmsI GCATC 1 cut(s) 112
BpmI CTGGAG 1 cut(s) 128
BsaBI GATNNNNATC 1 cut(s) 203
Bsc4I CCNNNNNNNGG 1 cut(s) 75
Bse8I GATNNNNATC 1 cut(s) 203
BseJI GATNNNNATC 1 cut(s) 203
BseLI CCNNNNNNNGG 1 cut(s) 75
BseRI GAGGAG 1 cut(s) 203
BslI CCNNNNNNNGG 1 cut(s) 75
Bsp143I GATC 1 cut(s) 123
BssMI GATC 1 cut(s) 123
Bst6I CTCTTC 1 cut(s) 180
BstKTI GATC 1 cut(s) 126
BstMBI GATC 1 cut(s) 123
BstSFI CTRYAG 1 cut(s) 35
CviAII CATG 1 cut(s) 217
CviJI RGCY 5 cut(s) 5, 68, 79, 130, 137
CviKI_1 RGCY 5 cut(s) 5, 68, 79, 130, 137
DpnI GATC 1 cut(s) 125
DpnII GATC 1 cut(s) 123
Eam1104I CTCTTC 1 cut(s) 180
EarI CTCTTC 1 cut(s) 180
FaeI CATG 1 cut(s) 220
FaiI YATR 5 cut(s) 71, 116, 134, 210, 218
FatI CATG 1 cut(s) 216
FspBI CTAG 1 cut(s) 93
GsuI CTGGAG 1 cut(s) 128
Hin1II CATG 1 cut(s) 220
HindIII AAGCTT 1 cut(s) 128
HinfI GANTC 1 cut(s) 165
Hpy188III TCNNGA 2 cut(s) 59, 107
Hsp92II CATG 1 cut(s) 220
Kzo9I GATC 1 cut(s) 123
LpnPI CCDG 4 cut(s) 23, 63, 92, 158
LweI GCATC 1 cut(s) 112
MaeI CTAG 1 cut(s) 93
MalI GATC 1 cut(s) 125
MboI GATC 1 cut(s) 123
MboII GAAGA 2 cut(s) 20, 197
MfeI CAATTG 1 cut(s) 223
MluCI AATT 1 cut(s) 223
MlyI GAGTC 1 cut(s) 159
MnlI CCTC 2 cut(s) 181, 184
MseI TTAA 1 cut(s) 203
MunI CAATTG 1 cut(s) 223
NdeII GATC 1 cut(s) 123
NlaIII CATG 1 cut(s) 220
PleI GAGTC 1 cut(s) 159
PpsI GAGTC 1 cut(s) 159
PshBI ATTAAT 1 cut(s) 203
SaqAI TTAA 1 cut(s) 203
Sau3AI GATC 1 cut(s) 123
SchI GAGTC 1 cut(s) 159
SetI ASST 1 cut(s) 132
SfaNI GCATC 1 cut(s) 112
SfcI CTRYAG 1 cut(s) 35
Sse9I AATT 1 cut(s) 223
SspMI CTAG 1 cut(s) 93
TasI AATT 1 cut(s) 223
Tru1I TTAA 1 cut(s) 203
Tru9I TTAA 1 cut(s) 203
TspDTI ATGAA 3 cut(s) 20, 103, 205
VspI ATTAAT 1 cut(s) 203
XspI CTAG 1 cut(s) 93
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.