RchiOBHm_Chr1g0317391

Pentatricopeptide repeat-containing protein At3g46790

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Forward (+)
4993885 .. 4994266
382 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 381 bp
ATGAAAGGACGAGGATATAAGCCACAGACTAAAGTTGTCCTCGATGATCTTGATGAGGAAGAGAAGGAACGTATGGTATTAGGCCATAGTGAAAAGTTATCAGTTGCATTTGGTCTCACCAATACCAAAAATGGGGAAACCATTCGGATTTCCAAGAATTTGAGGCAATATGAAGATTGCCACTATGTTACAAAGTTCATATCCAAGTTTACCAATAAAGAGATTCTAGTCCGAGATGTGAATCGGTTTCACCCTTTCCGTGACGGGGTTTGTTCATGCGGGGATTATTGGAAAGTGCAAACAATTATTCTTTCATTTTTGCTAGAAATTATTCTATGCACCGACGGTGCAAGTAACCCAACACTTATAAAACAATCTTAA

Protein Analysis

126

Amino Acids

14.5

Weight (kDa)

8.34

Isoelectric Point (pI)

36.41

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DYW_deaminase PF14432 5 - 97 8.5e-39 DYW family of nucleic acid deaminases
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0024518)

Species Orthologous Gene IDs
prunus_persica Prupe.2G020900_v2.0.a1
rosa_chinensis RchiOBHm_Chr1g0317391
rosa_multiflora Rmu_sc0001403.1_g000007

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 368
AciI CCGC 1 cut(s) 279
AcsI RAATTY 1 cut(s) 157
AfiI CCNNNNNNNGG 2 cut(s) 132, 265
Alw26I GTCTC 1 cut(s) 119
AoxI GGCC 1 cut(s) 82
ApoI RAATTY 1 cut(s) 157
Asp700I GAANNNNTTC 2 cut(s) 141, 330
AsuHPI GGTGA 2 cut(s) 109, 242
BcoDI GTCTC 1 cut(s) 119
BfaI CTAG 2 cut(s) 227, 323
BsaBI GATNNNNATC 1 cut(s) 240
BsaI GGTCTC 1 cut(s) 119
Bsc4I CCNNNNNNNGG 2 cut(s) 132, 265
Bse8I GATNNNNATC 1 cut(s) 240
BseJI GATNNNNATC 1 cut(s) 240
BseLI CCNNNNNNNGG 2 cut(s) 132, 265
BshFI GGCC 1 cut(s) 84
BslI CCNNNNNNNGG 2 cut(s) 132, 265
BsmAI GTCTC 1 cut(s) 119
BsnI GGCC 1 cut(s) 84
Bso31I GGTCTC 1 cut(s) 119
Bsp143I GATC 1 cut(s) 46
BspACI CCGC 1 cut(s) 279
BspANI GGCC 1 cut(s) 84
BspTNI GGTCTC 1 cut(s) 119
BssMI GATC 1 cut(s) 46
Bst4CI ACNGT 1 cut(s) 347
Bst6I CTCTTC 1 cut(s) 54
BstKTI GATC 1 cut(s) 49
BstMAI GTCTC 1 cut(s) 119
BstMBI GATC 1 cut(s) 46
BsuRI GGCC 1 cut(s) 84
CviAII CATG 1 cut(s) 276
CviJI RGCY 2 cut(s) 22, 84
CviKI_1 RGCY 2 cut(s) 22, 84
DpnI GATC 1 cut(s) 48
DpnII GATC 1 cut(s) 46
Eam1104I CTCTTC 1 cut(s) 54
EarI CTCTTC 1 cut(s) 54
Eco31I GGTCTC 1 cut(s) 119
FaeI CATG 1 cut(s) 279
FaiI YATR 9 cut(s) 18, 74, 87, 171, 186, 200, 277, 337, 368
FatI CATG 1 cut(s) 275
FauI CCCGC 1 cut(s) 272
FspBI CTAG 2 cut(s) 227, 323
HaeIII GGCC 1 cut(s) 84
Hin1II CATG 1 cut(s) 279
HinfI GANTC 2 cut(s) 223, 241
HphI GGTGA 2 cut(s) 109, 242
Hpy166II GTNNAC 1 cut(s) 210
Hpy188I TCNGA 2 cut(s) 147, 233
Hpy188III TCNNGA 1 cut(s) 50
Hpy8I GTNNAC 1 cut(s) 210
Hpy99I CGWCG 1 cut(s) 347
HpyAV CCTTC 1 cut(s) 58
HpyCH4III ACNGT 1 cut(s) 347
HpyCH4IV ACGT 1 cut(s) 70
HpyCH4V TGCA 4 cut(s) 107, 298, 339, 350
HpySE526I ACGT 1 cut(s) 70
Hsp92II CATG 1 cut(s) 279
Kzo9I GATC 1 cut(s) 46
MaeI CTAG 2 cut(s) 227, 323
MaeII ACGT 1 cut(s) 70
MaeIII GTNAC 3 cut(s) 187, 260, 353
MalI GATC 1 cut(s) 48
MboI GATC 1 cut(s) 46
MboII GAAGA 2 cut(s) 71, 185
MluCI AATT 3 cut(s) 157, 303, 327
MnlI CCTC 4 cut(s) 5, 49, 50, 156
MroXI GAANNNNTTC 2 cut(s) 141, 330
MseI TTAA 1 cut(s) 379
NdeII GATC 1 cut(s) 46
NlaIII CATG 1 cut(s) 279
NmuCI GTSAC 1 cut(s) 260
PdmI GAANNNNTTC 2 cut(s) 141, 330
PfeI GAWTC 2 cut(s) 223, 241
PsiI TTATAA 1 cut(s) 368
SaqAI TTAA 1 cut(s) 379
Sau3AI GATC 1 cut(s) 46
SetI ASST 1 cut(s) 73
Sse9I AATT 3 cut(s) 157, 303, 327
SsiI CCGC 1 cut(s) 279
SspMI CTAG 2 cut(s) 227, 323
TaaI ACNGT 1 cut(s) 347
TaiI ACGT 1 cut(s) 73
TaqI TCGA 1 cut(s) 42
TasI AATT 3 cut(s) 157, 303, 327
TfiI GAWTC 2 cut(s) 223, 241
Tru1I TTAA 1 cut(s) 379
Tru9I TTAA 1 cut(s) 379
TseFI GTSAC 1 cut(s) 260
Tsp45I GTSAC 1 cut(s) 260
TspDTI ATGAA 5 cut(s) 17, 186, 187, 264, 303
TspGWI ACGGA 1 cut(s) 248
XapI RAATTY 1 cut(s) 157
XmnI GAANNNNTTC 2 cut(s) 141, 330
XspI CTAG 2 cut(s) 227, 323
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.