Rmu_sc0001403.1_g000007

Pentatricopeptide repeat-containing protein At3g46790

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001403.1
Physical Location & Seq
Forward (+)
16482 .. 16775
294 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001403.1_g000007.1.cds

Sequence Viewer

Length: 294 bp
atgaaaggacgaggatataagccacagactaaagttgtcctctatgatcttgatgaggaagagaaggaacgtatggtattaggccatagtgaaaagctatcagttgcatttggtctcaccaataccaaaaatggggaagccattcggatttccaagaatttgaggcaatgtgaagattgccattatgttacaaagttcataaacaagtttaccaataaagagattctagtccgagatgtgaatcggtttcaccctttccgtgacggggtttgttcatgcggggattattggtag

Protein Analysis

97

Amino Acids

11.35

Weight (kDa)

8.71

Isoelectric Point (pI)

36.61

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0024518)

Species Orthologous Gene IDs
prunus_persica Prupe.2G020900_v2.0.a1
rosa_chinensis RchiOBHm_Chr1g0317391
rosa_multiflora Rmu_sc0001403.1_g000007

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 279
AcsI RAATTY 1 cut(s) 157
AfiI CCNNNNNNNGG 2 cut(s) 132, 265
AluBI AGCT 1 cut(s) 97
AluI AGCT 1 cut(s) 97
Alw26I GTCTC 1 cut(s) 119
AoxI GGCC 1 cut(s) 82
ApoI RAATTY 1 cut(s) 157
Asp700I GAANNNNTTC 1 cut(s) 141
AsuHPI GGTGA 2 cut(s) 109, 242
BcoDI GTCTC 1 cut(s) 119
BfaI CTAG 1 cut(s) 227
BsaBI GATNNNNATC 1 cut(s) 240
BsaI GGTCTC 1 cut(s) 119
Bsc4I CCNNNNNNNGG 2 cut(s) 132, 265
Bse3DI GCAATG 1 cut(s) 173
Bse8I GATNNNNATC 1 cut(s) 240
BseJI GATNNNNATC 1 cut(s) 240
BseLI CCNNNNNNNGG 2 cut(s) 132, 265
BseMI GCAATG 1 cut(s) 173
BshFI GGCC 1 cut(s) 84
BslI CCNNNNNNNGG 2 cut(s) 132, 265
BsmAI GTCTC 1 cut(s) 119
BsnI GGCC 1 cut(s) 84
Bso31I GGTCTC 1 cut(s) 119
Bsp143I GATC 1 cut(s) 46
BspACI CCGC 1 cut(s) 279
BspANI GGCC 1 cut(s) 84
BspTNI GGTCTC 1 cut(s) 119
BsrDI GCAATG 1 cut(s) 173
BssMI GATC 1 cut(s) 46
Bst6I CTCTTC 1 cut(s) 54
BstKTI GATC 1 cut(s) 49
BstMAI GTCTC 1 cut(s) 119
BstMBI GATC 1 cut(s) 46
BsuRI GGCC 1 cut(s) 84
CviAII CATG 1 cut(s) 276
CviJI RGCY 4 cut(s) 22, 84, 97, 140
CviKI_1 RGCY 4 cut(s) 22, 84, 97, 140
DpnI GATC 1 cut(s) 48
DpnII GATC 1 cut(s) 46
Eam1104I CTCTTC 1 cut(s) 54
EarI CTCTTC 1 cut(s) 54
Eco31I GGTCTC 1 cut(s) 119
FaeI CATG 1 cut(s) 279
FaiI YATR 7 cut(s) 18, 45, 74, 87, 186, 200, 277
FatI CATG 1 cut(s) 275
FauI CCCGC 1 cut(s) 272
FspBI CTAG 1 cut(s) 227
HaeIII GGCC 1 cut(s) 84
Hin1II CATG 1 cut(s) 279
HinfI GANTC 2 cut(s) 223, 241
HphI GGTGA 2 cut(s) 109, 242
Hpy166II GTNNAC 1 cut(s) 210
Hpy188I TCNGA 2 cut(s) 147, 233
Hpy188III TCNNGA 1 cut(s) 50
Hpy8I GTNNAC 1 cut(s) 210
HpyAV CCTTC 1 cut(s) 58
HpyCH4IV ACGT 1 cut(s) 70
HpyCH4V TGCA 1 cut(s) 107
HpySE526I ACGT 1 cut(s) 70
Hsp92II CATG 1 cut(s) 279
Kzo9I GATC 1 cut(s) 46
MaeI CTAG 1 cut(s) 227
MaeII ACGT 1 cut(s) 70
MaeIII GTNAC 2 cut(s) 187, 260
MalI GATC 1 cut(s) 48
MboI GATC 1 cut(s) 46
MboII GAAGA 2 cut(s) 71, 185
MluCI AATT 1 cut(s) 157
MnlI CCTC 4 cut(s) 5, 49, 50, 156
MroXI GAANNNNTTC 1 cut(s) 141
NdeII GATC 1 cut(s) 46
NlaIII CATG 1 cut(s) 279
NmuCI GTSAC 1 cut(s) 260
PdmI GAANNNNTTC 1 cut(s) 141
PfeI GAWTC 2 cut(s) 223, 241
Sau3AI GATC 1 cut(s) 46
SetI ASST 2 cut(s) 73, 99
SgeI CNNG 9 cut(s) 23, 62, 166, 217, 239, 245, 272, 277, 288
Sse9I AATT 1 cut(s) 157
SsiI CCGC 1 cut(s) 279
SspMI CTAG 1 cut(s) 227
TaiI ACGT 1 cut(s) 73
TasI AATT 1 cut(s) 157
TfiI GAWTC 2 cut(s) 223, 241
TseFI GTSAC 1 cut(s) 260
Tsp45I GTSAC 1 cut(s) 260
TspDTI ATGAA 3 cut(s) 17, 187, 264
TspGWI ACGGA 1 cut(s) 248
XapI RAATTY 1 cut(s) 157
XmnI GAANNNNTTC 1 cut(s) 141
XspI CTAG 1 cut(s) 227
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.