RchiOBHm_Chr1g0327531

breast cancer carboxy-terminal domain

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Reverse (-)
16408891 .. 16409668
778 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 294 bp
ATGCAGATGTGTTGTATGCAATGGTTATGTATCCACTCAACCATGCATCTTGCATCCATTCAACCACTAGCAAGGTACTCGTCAAATGCTTCCTCTATCATCATCATCTTGGTTTCTCTTCCACTTGGACCAATGAGACTTGTTTGCGCCAAGCACCTAGCAAGCACGACTGCATCTTCTAAAGAAGCTGACCCGCCCTGTGCAAGGAATGGAGCCGTTGCATGCATCGCATCTCCTGCCAGCATCACTGGTCCAATTCAACTGTGTTGTCCTACAGTGACCAGTGGTGCATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

97

Amino Acids

10.07

Weight (kDa)

8.51

Isoelectric Point (pI)

39.32

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0022606)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr1g0327531
rosa_rugosa Rorug01G0068100
rosa_samantha Rh1BG067400 Rh1DG089400

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 194
AfaI GTAC 1 cut(s) 77
AfiI CCNNNNNNNGG 1 cut(s) 204
AgsI TTSAA 2 cut(s) 62, 260
AluBI AGCT 1 cut(s) 188
AluI AGCT 1 cut(s) 188
Alw26I GTCTC 1 cut(s) 130
AspLEI GCGC 1 cut(s) 149
AspS9I GGNCC 2 cut(s) 128, 251
AvaII GGWCC 2 cut(s) 128, 251
BceAI ACGGC 1 cut(s) 200
BcgI CGANNNNNNTGC 2 cut(s) 60, 94
BciVI GTATCC 1 cut(s) 41
BcoDI GTCTC 1 cut(s) 130
BfaI CTAG 2 cut(s) 68, 158
BfmI CTRYAG 1 cut(s) 273
BfuI GTATCC 1 cut(s) 41
Bme18I GGWCC 2 cut(s) 128, 251
BmgT120I GGNCC 2 cut(s) 128, 251
BmiI GGNNCC 1 cut(s) 214
BmsI GCATC 6 cut(s) 55, 62, 182, 234, 239, 252
Bsc4I CCNNNNNNNGG 1 cut(s) 204
Bse1I ACTGG 2 cut(s) 253, 282
Bse3DI GCAATG 1 cut(s) 26
BseGI GGATG 1 cut(s) 53
BseLI CCNNNNNNNGG 1 cut(s) 204
BseMI GCAATG 1 cut(s) 26
BseNI ACTGG 2 cut(s) 253, 282
BslI CCNNNNNNNGG 1 cut(s) 204
BsmAI GTCTC 1 cut(s) 130
BspACI CCGC 1 cut(s) 194
BspLI GGNNCC 1 cut(s) 214
BsrDI GCAATG 1 cut(s) 26
BsrI ACTGG 2 cut(s) 253, 282
Bst4CI ACNGT 2 cut(s) 264, 277
Bst6I CTCTTC 1 cut(s) 123
BstAPI GCANNNNNTGC 1 cut(s) 236
BstC8I GCNNGC 3 cut(s) 163, 223, 241
BstENI CCTNNNNNAGG 1 cut(s) 202
BstF5I GGATG 1 cut(s) 53
BstHHI GCGC 1 cut(s) 149
BstMAI GTCTC 1 cut(s) 130
BstMWI GCNNNNNNNGC 2 cut(s) 227, 236
BstNSI RCATGY 1 cut(s) 225
BstSFI CTRYAG 1 cut(s) 273
BsuI GTATCC 1 cut(s) 41
BtgZI GCGATG 1 cut(s) 211
BtsCI GGATG 1 cut(s) 53
BtsIMutI CAGTG 3 cut(s) 246, 282, 289
Cac8I GCNNGC 3 cut(s) 163, 223, 241
CfoI GCGC 1 cut(s) 149
Cfr13I GGNCC 2 cut(s) 128, 251
Csp6I GTAC 1 cut(s) 76
CviAII CATG 3 cut(s) 43, 222, 291
CviJI RGCY 2 cut(s) 188, 215
CviKI_1 RGCY 2 cut(s) 188, 215
CviQI GTAC 1 cut(s) 76
Eam1104I CTCTTC 1 cut(s) 123
EarI CTCTTC 1 cut(s) 123
Eco47I GGWCC 2 cut(s) 128, 251
EcoNI CCTNNNNNAGG 1 cut(s) 202
EcoT22I ATGCAT 2 cut(s) 48, 227
FaeI CATG 3 cut(s) 46, 225, 294
FaiI YATR 5 cut(s) 17, 28, 44, 223, 292
FatI CATG 3 cut(s) 42, 221, 290
FauI CCCGC 1 cut(s) 201
FokI GGATG 1 cut(s) 40
FspBI CTAG 2 cut(s) 68, 158
GlaI GCGC 1 cut(s) 148
HhaI GCGC 1 cut(s) 149
Hin1II CATG 3 cut(s) 46, 225, 294
Hin6I GCGC 1 cut(s) 147
HinP1I GCGC 1 cut(s) 147
HpyCH4III ACNGT 2 cut(s) 264, 277
HpyCH4V TGCA 9 cut(s) 4, 19, 46, 53, 173, 203, 221, 225, 290
HpyF10VI GCNNNNNNNGC 2 cut(s) 227, 236
Hsp92II CATG 3 cut(s) 46, 225, 294
HspAI GCGC 1 cut(s) 147
LmnI GCTCC 1 cut(s) 212
LweI GCATC 6 cut(s) 55, 62, 182, 234, 239, 252
MaeI CTAG 2 cut(s) 68, 158
MaeIII GTNAC 1 cut(s) 277
MboII GAAGA 2 cut(s) 110, 168
MluCI AATT 1 cut(s) 255
MnlI CCTC 1 cut(s) 103
Mph1103I ATGCAT 2 cut(s) 48, 227
MwoI GCNNNNNNNGC 2 cut(s) 227, 236
NlaIII CATG 3 cut(s) 46, 225, 294
NlaIV GGNNCC 1 cut(s) 214
NmuCI GTSAC 1 cut(s) 277
NsiI ATGCAT 2 cut(s) 48, 227
NspI RCATGY 1 cut(s) 225
PaeI GCATGC 1 cut(s) 225
PspN4I GGNNCC 1 cut(s) 214
PspPI GGNCC 2 cut(s) 128, 251
RsaI GTAC 1 cut(s) 77
RsaNI GTAC 1 cut(s) 76
Sau96I GGNCC 2 cut(s) 128, 251
SetI ASST 3 cut(s) 77, 159, 190
SfaNI GCATC 6 cut(s) 55, 62, 182, 234, 239, 252
SfcI CTRYAG 1 cut(s) 273
SinI GGWCC 2 cut(s) 128, 251
SphI GCATGC 1 cut(s) 225
Sse9I AATT 1 cut(s) 255
SsiI CCGC 1 cut(s) 194
SspMI CTAG 2 cut(s) 68, 158
TaaI ACNGT 2 cut(s) 264, 277
TasI AATT 1 cut(s) 255
TscAI CASTG 3 cut(s) 253, 282, 289
TseFI GTSAC 1 cut(s) 277
Tsp45I GTSAC 1 cut(s) 277
TspRI CASTG 3 cut(s) 253, 282, 289
VpaK11BI GGWCC 2 cut(s) 128, 251
XagI CCTNNNNNAGG 1 cut(s) 202
XceI RCATGY 1 cut(s) 225
XspI CTAG 2 cut(s) 68, 158
Zsp2I ATGCAT 2 cut(s) 48, 227
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.