Rh1BG067400

breast cancer carboxy-terminal domain

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1B
Physical Location & Seq
Reverse (-)
10305739 .. 10306247
509 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1BG067400.1

Sequence Viewer

Length: 252 bp
ATGCATCTTGCATCCATTCAACCACTAGCAAGGTACTCGTCAAATGCTTCCTCTATCATCATCATCTTGGTTTATCTTCCACTTGGACCAATGAGACTTGTTTGCGCCAAGCACCTAGCAAGCACGACTGCATCTTCTAAAGAAGCTGACCCGCCCTGTGCAAGGAATGGAGCCGTTGCATGCATCGCATCTCCTGCCAGCGTCACTGGTCCAATTCAACTGTGTTGTCCTACTGTGACCAGTGGTGCATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

83

Amino Acids

8.44

Weight (kDa)

8.75

Isoelectric Point (pI)

37.25

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0022606)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr1g0327531
rosa_rugosa Rorug01G0068100
rosa_samantha Rh1BG067400 Rh1DG089400

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 152
AfaI GTAC 1 cut(s) 35
AfiI CCNNNNNNNGG 1 cut(s) 162
AgsI TTSAA 2 cut(s) 20, 218
AluBI AGCT 1 cut(s) 146
AluI AGCT 1 cut(s) 146
Alw26I GTCTC 1 cut(s) 88
AspLEI GCGC 1 cut(s) 107
AspS9I GGNCC 2 cut(s) 86, 209
AvaII GGWCC 2 cut(s) 86, 209
BceAI ACGGC 1 cut(s) 158
BcgI CGANNNNNNTGC 2 cut(s) 18, 52
BcoDI GTCTC 1 cut(s) 88
BfaI CTAG 2 cut(s) 26, 116
Bme18I GGWCC 2 cut(s) 86, 209
BmgT120I GGNCC 2 cut(s) 86, 209
BmiI GGNNCC 1 cut(s) 172
BmsI GCATC 5 cut(s) 13, 20, 140, 192, 197
Bsc4I CCNNNNNNNGG 1 cut(s) 162
Bse1I ACTGG 2 cut(s) 211, 240
BseGI GGATG 1 cut(s) 11
BseLI CCNNNNNNNGG 1 cut(s) 162
BseNI ACTGG 2 cut(s) 211, 240
BslI CCNNNNNNNGG 1 cut(s) 162
BsmAI GTCTC 1 cut(s) 88
BspACI CCGC 1 cut(s) 152
BspLI GGNNCC 1 cut(s) 172
BsrI ACTGG 2 cut(s) 211, 240
Bst4CI ACNGT 2 cut(s) 222, 235
BstAPI GCANNNNNTGC 1 cut(s) 194
BstC8I GCNNGC 3 cut(s) 121, 181, 199
BstENI CCTNNNNNAGG 1 cut(s) 160
BstF5I GGATG 1 cut(s) 11
BstHHI GCGC 1 cut(s) 107
BstMAI GTCTC 1 cut(s) 88
BstMWI GCNNNNNNNGC 2 cut(s) 185, 194
BstNSI RCATGY 1 cut(s) 183
BtgZI GCGATG 1 cut(s) 169
BtsCI GGATG 1 cut(s) 11
BtsIMutI CAGTG 2 cut(s) 204, 247
Cac8I GCNNGC 3 cut(s) 121, 181, 199
CfoI GCGC 1 cut(s) 107
Cfr13I GGNCC 2 cut(s) 86, 209
CseI GACGC 1 cut(s) 190
Csp6I GTAC 1 cut(s) 34
CviAII CATG 2 cut(s) 180, 249
CviJI RGCY 2 cut(s) 146, 173
CviKI_1 RGCY 2 cut(s) 146, 173
CviQI GTAC 1 cut(s) 34
Eco47I GGWCC 2 cut(s) 86, 209
EcoNI CCTNNNNNAGG 1 cut(s) 160
EcoT22I ATGCAT 2 cut(s) 6, 185
FaeI CATG 2 cut(s) 183, 252
FaiI YATR 2 cut(s) 181, 250
FatI CATG 2 cut(s) 179, 248
FauI CCCGC 1 cut(s) 159
FspBI CTAG 2 cut(s) 26, 116
GlaI GCGC 1 cut(s) 106
HgaI GACGC 1 cut(s) 190
HhaI GCGC 1 cut(s) 107
Hin1II CATG 2 cut(s) 183, 252
Hin6I GCGC 1 cut(s) 105
HinP1I GCGC 1 cut(s) 105
HpyCH4III ACNGT 2 cut(s) 222, 235
HpyCH4V TGCA 7 cut(s) 4, 11, 131, 161, 179, 183, 248
HpyF10VI GCNNNNNNNGC 2 cut(s) 185, 194
Hsp92II CATG 2 cut(s) 183, 252
HspAI GCGC 1 cut(s) 105
LmnI GCTCC 1 cut(s) 170
LpnPI CCDG 4 cut(s) 169, 192, 207, 211
LweI GCATC 5 cut(s) 13, 20, 140, 192, 197
MaeI CTAG 2 cut(s) 26, 116
MaeIII GTNAC 2 cut(s) 202, 235
MboII GAAGA 2 cut(s) 68, 126
MluCI AATT 1 cut(s) 213
MnlI CCTC 1 cut(s) 61
Mph1103I ATGCAT 2 cut(s) 6, 185
MwoI GCNNNNNNNGC 2 cut(s) 185, 194
NlaIII CATG 2 cut(s) 183, 252
NlaIV GGNNCC 1 cut(s) 172
NmuCI GTSAC 2 cut(s) 202, 235
NsiI ATGCAT 2 cut(s) 6, 185
NspI RCATGY 1 cut(s) 183
PaeI GCATGC 1 cut(s) 183
PspN4I GGNNCC 1 cut(s) 172
PspPI GGNCC 2 cut(s) 86, 209
RsaI GTAC 1 cut(s) 35
RsaNI GTAC 1 cut(s) 34
Sau96I GGNCC 2 cut(s) 86, 209
SetI ASST 3 cut(s) 35, 117, 148
SfaNI GCATC 5 cut(s) 13, 20, 140, 192, 197
SinI GGWCC 2 cut(s) 86, 209
SphI GCATGC 1 cut(s) 183
Sse9I AATT 1 cut(s) 213
SsiI CCGC 1 cut(s) 152
SspMI CTAG 2 cut(s) 26, 116
TaaI ACNGT 2 cut(s) 222, 235
TasI AATT 1 cut(s) 213
TscAI CASTG 2 cut(s) 211, 247
TseFI GTSAC 2 cut(s) 202, 235
Tsp45I GTSAC 2 cut(s) 202, 235
TspRI CASTG 2 cut(s) 211, 247
VpaK11BI GGWCC 2 cut(s) 86, 209
XagI CCTNNNNNAGG 1 cut(s) 160
XceI RCATGY 1 cut(s) 183
XspI CTAG 2 cut(s) 26, 116
Zsp2I ATGCAT 2 cut(s) 6, 185
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.