RchiOBHm_Chr1g0352451

Ran guanine nucleotide release

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Reverse (-)
45861960 .. 45863542
1583 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 213 bp
ATGACAACCGAATTTGAGGCAGAATCTCAGCCAAAAGAGGCTGAGGAAAGTGTGGTGATTGAGCAGTCGGGAGTAGTTGAGGTTCCTGGACTATGTTACAGAAACATACCTGCTGTTGTTACAACTGCAATTGGCGAAATGTTTGCGATGGGCGAGGTTTTTGGTGCTGGGTTTGTTTTGGATTACTTGCTTTTGGTCCATAAAGCTTGGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

70

Amino Acids

7.64

Weight (kDa)

4.2

Isoelectric Point (pI)

52.68

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0022607)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr1g0352451
rosa_roxburghii Rroxscaffold_3G00255850
rosa_rugosa Rorug07G0061400
rosa_samantha Rh7BG190300

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 118
AcsI RAATTY 1 cut(s) 11
AjnI CCWGG 1 cut(s) 85
AluBI AGCT 1 cut(s) 206
AluI AGCT 1 cut(s) 206
ApoI RAATTY 1 cut(s) 11
AspS9I GGNCC 1 cut(s) 196
AsuHPI GGTGA 1 cut(s) 67
AvaII GGWCC 1 cut(s) 196
BbvCI CCTCAGC 1 cut(s) 42
BccI CCATC 1 cut(s) 142
BcgI CGANNNNNNTGC 2 cut(s) 125, 159
BciT130I CCWGG 1 cut(s) 87
BfuAI ACCTGC 1 cut(s) 118
Bme1390I CCNGG 1 cut(s) 87
Bme18I GGWCC 1 cut(s) 196
BmgT120I GGNCC 1 cut(s) 196
BmiI GGNNCC 1 cut(s) 84
BmrFI CCNGG 1 cut(s) 87
Bpu10I CCTNAGC 1 cut(s) 42
BseBI CCWGG 1 cut(s) 87
BseMII CTCAG 2 cut(s) 33, 41
BseYI CCCAGC 1 cut(s) 167
BspCNI CTCAG 2 cut(s) 34, 40
BspLI GGNNCC 1 cut(s) 84
BspMI ACCTGC 1 cut(s) 118
Bst2UI CCWGG 1 cut(s) 87
BstDEI CTNAG 2 cut(s) 27, 42
BstNI CCWGG 1 cut(s) 87
BstSCI CCNGG 1 cut(s) 85
BtgZI GCGATG 1 cut(s) 161
BveI ACCTGC 1 cut(s) 118
Cfr13I GGNCC 1 cut(s) 196
CviJI RGCY 3 cut(s) 31, 41, 206
CviKI_1 RGCY 3 cut(s) 31, 41, 206
DdeI CTNAG 2 cut(s) 27, 42
Eco47I GGWCC 1 cut(s) 196
EcoRII CCWGG 1 cut(s) 85
FaiI YATR 3 cut(s) 94, 107, 201
GsaI CCCAGC 1 cut(s) 171
HindIII AAGCTT 1 cut(s) 204
HinfI GANTC 1 cut(s) 23
HphI GGTGA 1 cut(s) 67
Hpy188III TCNNGA 1 cut(s) 69
HpyCH4V TGCA 1 cut(s) 128
HpyF3I CTNAG 2 cut(s) 27, 42
LpnPI CCDG 4 cut(s) 72, 99, 123, 153
MaeIII GTNAC 2 cut(s) 95, 118
MfeI CAATTG 1 cut(s) 129
MluCI AATT 2 cut(s) 11, 129
MnlI CCTC 5 cut(s) 10, 31, 37, 73, 148
MspR9I CCNGG 1 cut(s) 87
MunI CAATTG 1 cut(s) 129
MvaI CCWGG 1 cut(s) 87
NlaIV GGNNCC 1 cut(s) 84
PfeI GAWTC 1 cut(s) 23
PfoI TCCNGGA 1 cut(s) 85
Psp6I CCWGG 1 cut(s) 85
PspFI CCCAGC 1 cut(s) 167
PspGI CCWGG 1 cut(s) 85
PspN4I GGNNCC 1 cut(s) 84
PspPI GGNCC 1 cut(s) 196
PsrI GAACNNNNNNTAC 2 cut(s) 66, 98
Sau96I GGNCC 1 cut(s) 196
ScrFI CCNGG 1 cut(s) 87
SetI ASST 4 cut(s) 84, 112, 159, 208
SgeI CNNG 7 cut(s) 81, 98, 99, 122, 166, 180, 199
SinI GGWCC 1 cut(s) 196
Sse9I AATT 2 cut(s) 11, 129
StyD4I CCNGG 1 cut(s) 85
TasI AATT 2 cut(s) 11, 129
TfiI GAWTC 1 cut(s) 23
VpaK11BI GGWCC 1 cut(s) 196
XapI RAATTY 1 cut(s) 11
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.