Rh7BG190300

Mog1 PsbP DUF1795, alpha beta alpha sandwich (InterPro IPR016124), Ran-interacting Mog1 protein (InterPro IPR007681), Mog1 PsbP, alpha beta alpha sandwich (InterPro IPR016123)

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7B
OG0022607
Physical Location & Seq
Reverse (-)
15383574 .. 15387315
3742 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7BG190300.1

Sequence Viewer

Length: 213 bp
ATGATCGATTTACGTCGTTCACAGCTTCCCTGGCCTCCTCCTAGCCAACCAATTTCCACTCTAGCTTCACCGCGCGTGATTGAGCAGTCGGGAGAAGTTGAGGTTCCCGGACCATGTTACAGAATCATACCGGCTGTTGTTACAACTGCAGTTGGCCAAATGGGCTTCATGATCTACATAGTCTCTGCAAGCCATGCAAGACTGAGTGCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Mog1

Protein Analysis

70

Amino Acids

7.57

Weight (kDa)

7.98

Isoelectric Point (pI)

63.31

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0022607)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr1g0352451
rosa_roxburghii Rroxscaffold_3G00255850
rosa_rugosa Rorug07G0061400
rosa_samantha Rh7BG190300

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 2 cut(s) 73, 75
AciI CCGC 1 cut(s) 71
AcoI YGGCCR 1 cut(s) 154
AjnI CCWGG 1 cut(s) 29
AluBI AGCT 2 cut(s) 25, 65
AluI AGCT 2 cut(s) 25, 65
Alw26I GTCTC 1 cut(s) 187
AoxI GGCC 2 cut(s) 32, 154
AspLEI GCGC 1 cut(s) 75
AspS9I GGNCC 1 cut(s) 110
AsuC2I CCSGG 1 cut(s) 108
AsuHPI GGTGA 1 cut(s) 60
AvaII GGWCC 1 cut(s) 110
BalI TGGCCA 1 cut(s) 156
BciT130I CCWGG 1 cut(s) 31
BcnI CCSGG 1 cut(s) 108
BcoDI GTCTC 1 cut(s) 187
BfaI CTAG 2 cut(s) 42, 62
BfmI CTRYAG 1 cut(s) 147
BglI GCCNNNNNGGC 1 cut(s) 162
Bme1390I CCNGG 2 cut(s) 31, 108
Bme18I GGWCC 1 cut(s) 110
BmgT120I GGNCC 1 cut(s) 110
BmiI GGNNCC 1 cut(s) 105
BmrFI CCNGG 2 cut(s) 31, 108
BpuMI CCSGG 1 cut(s) 108
Bsa29I ATCGAT 1 cut(s) 6
BsaJI CCNNGG 1 cut(s) 29
Bse118I RCCGGY 1 cut(s) 130
BseBI CCWGG 1 cut(s) 31
BseCI ATCGAT 1 cut(s) 6
BseDI CCNNGG 1 cut(s) 29
BseMII CTCAG 1 cut(s) 194
BseRI GAGGAG 1 cut(s) 27
Bsh1236I CGCG 2 cut(s) 73, 75
BshFI GGCC 2 cut(s) 34, 156
BshVI ATCGAT 1 cut(s) 6
BsiSI CCGG 2 cut(s) 108, 131
BsmAI GTCTC 1 cut(s) 187
BsnI GGCC 2 cut(s) 34, 156
Bsp143I GATC 2 cut(s) 3, 171
BspACI CCGC 1 cut(s) 71
BspANI GGCC 2 cut(s) 34, 156
BspCNI CTCAG 1 cut(s) 195
BspDI ATCGAT 1 cut(s) 6
BspFNI CGCG 2 cut(s) 73, 75
BspHI TCATGA 1 cut(s) 168
BspLI GGNNCC 1 cut(s) 105
BspMAI CTGCAG 1 cut(s) 151
BsrFI RCCGGY 1 cut(s) 130
BssAI RCCGGY 1 cut(s) 130
BssECI CCNNGG 1 cut(s) 29
BssMI GATC 2 cut(s) 3, 171
Bst2UI CCWGG 1 cut(s) 31
BstAPI GCANNNNNTGC 1 cut(s) 194
BstC8I GCNNGC 1 cut(s) 190
BstDEI CTNAG 1 cut(s) 203
BstFNI CGCG 2 cut(s) 73, 75
BstHHI GCGC 1 cut(s) 75
BstKTI GATC 2 cut(s) 6, 174
BstMAI GTCTC 1 cut(s) 187
BstMBI GATC 2 cut(s) 3, 171
BstMWI GCNNNNNNNGC 3 cut(s) 31, 162, 194
BstNI CCWGG 1 cut(s) 31
BstSCI CCNGG 2 cut(s) 29, 106
BstSFI CTRYAG 1 cut(s) 147
BstUI CGCG 2 cut(s) 73, 75
Bsu15I ATCGAT 1 cut(s) 6
BsuRI GGCC 2 cut(s) 34, 156
BsuTUI ATCGAT 1 cut(s) 6
Cac8I GCNNGC 1 cut(s) 190
CciI TCATGA 1 cut(s) 168
CfoI GCGC 1 cut(s) 75
Cfr10I RCCGGY 1 cut(s) 130
Cfr13I GGNCC 1 cut(s) 110
ClaI ATCGAT 1 cut(s) 6
CviAII CATG 3 cut(s) 114, 169, 194
CviJI RGCY 8 cut(s) 25, 34, 45, 65, 134, 156, 165, 192
CviKI_1 RGCY 8 cut(s) 25, 34, 45, 65, 134, 156, 165, 192
DdeI CTNAG 1 cut(s) 203
DpnI GATC 2 cut(s) 5, 173
DpnII GATC 2 cut(s) 3, 171
EaeI YGGCCR 1 cut(s) 154
Eco47I GGWCC 1 cut(s) 110
EcoRII CCWGG 1 cut(s) 29
FaeI CATG 3 cut(s) 117, 172, 197
FaiI YATR 5 cut(s) 115, 128, 170, 179, 195
FatI CATG 3 cut(s) 113, 168, 193
FspBI CTAG 2 cut(s) 42, 62
GlaI GCGC 1 cut(s) 74
HaeIII GGCC 2 cut(s) 34, 156
HapII CCGG 2 cut(s) 108, 131
HhaI GCGC 1 cut(s) 75
Hin1II CATG 3 cut(s) 117, 172, 197
Hin6I GCGC 1 cut(s) 73
HinP1I GCGC 1 cut(s) 73
HinfI GANTC 1 cut(s) 123
HpaII CCGG 2 cut(s) 108, 131
HphI GGTGA 1 cut(s) 60
Hpy166II GTNNAC 1 cut(s) 20
Hpy188III TCNNGA 2 cut(s) 90, 169
Hpy8I GTNNAC 1 cut(s) 20
Hpy99I CGWCG 1 cut(s) 18
HpyCH4IV ACGT 1 cut(s) 13
HpyCH4V TGCA 3 cut(s) 149, 188, 197
HpyF10VI GCNNNNNNNGC 3 cut(s) 31, 162, 194
HpyF3I CTNAG 1 cut(s) 203
HpySE526I ACGT 1 cut(s) 13
Hsp92II CATG 3 cut(s) 117, 172, 197
HspAI GCGC 1 cut(s) 73
Kzo9I GATC 2 cut(s) 3, 171
LpnPI CCDG 4 cut(s) 16, 43, 121, 144
MaeI CTAG 2 cut(s) 42, 62
MaeII ACGT 1 cut(s) 13
MaeIII GTNAC 2 cut(s) 116, 139
MalI GATC 2 cut(s) 5, 173
MboI GATC 2 cut(s) 3, 171
MlsI TGGCCA 1 cut(s) 156
MluCI AATT 1 cut(s) 51
MluNI TGGCCA 1 cut(s) 156
MnlI CCTC 3 cut(s) 45, 48, 94
Mox20I TGGCCA 1 cut(s) 156
MscI TGGCCA 1 cut(s) 156
Msp20I TGGCCA 1 cut(s) 156
MspI CCGG 2 cut(s) 108, 131
MspR9I CCNGG 2 cut(s) 31, 108
MvaI CCWGG 1 cut(s) 31
MvnI CGCG 2 cut(s) 73, 75
MwoI GCNNNNNNNGC 3 cut(s) 31, 162, 194
NciI CCSGG 1 cut(s) 108
NdeII GATC 2 cut(s) 3, 171
NlaIII CATG 3 cut(s) 117, 172, 197
NlaIV GGNNCC 1 cut(s) 105
PagI TCATGA 1 cut(s) 168
PfeI GAWTC 1 cut(s) 123
PfoI TCCNGGA 1 cut(s) 106
Psp6I CCWGG 1 cut(s) 29
PspGI CCWGG 1 cut(s) 29
PspN4I GGNNCC 1 cut(s) 105
PspPI GGNCC 1 cut(s) 110
PstI CTGCAG 1 cut(s) 151
Sau3AI GATC 2 cut(s) 3, 171
Sau96I GGNCC 1 cut(s) 110
ScrFI CCNGG 2 cut(s) 31, 108
SetI ASST 4 cut(s) 16, 27, 67, 105
SfcI CTRYAG 1 cut(s) 147
SinI GGWCC 1 cut(s) 110
Sse9I AATT 1 cut(s) 51
SsiI CCGC 1 cut(s) 71
SspMI CTAG 2 cut(s) 42, 62
StyD4I CCNGG 2 cut(s) 29, 106
TaiI ACGT 1 cut(s) 16
TaqI TCGA 1 cut(s) 6
TasI AATT 1 cut(s) 51
TfiI GAWTC 1 cut(s) 123
TspDTI ATGAA 1 cut(s) 157
VpaK11BI GGWCC 1 cut(s) 110
XspI CTAG 2 cut(s) 42, 62
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.