RchiOBHm_Chr1g0379071

Pentatricopeptide repeat-containing protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Reverse (-)
65245287 .. 65245673
387 bp
Loading structure...
UTR
Exon/CDS
Intron
N/A

Sequence Viewer

Length: 345 bp
ATGGACTTTGGGTTGGTGGGGTTGGCTGTGGAGATGTTTGATCAGATGCCAGAGAGGAATTGTTTTTCTTATAATGCTCTAATGGCTGGCTTTTGTCGAAATGGGGAAGGTTTGAGGGCATTGGAATTATTTATGAGAATGGTGGAGGAGGGTATGGAGCTGATAGAATTCACTCTGACTAGTGTTATTGGTGCTTGTGGATTGCTTATGGCTTTTCACTTTGCATGTTTATATTTTAAAAGGAGTAAGAAGATAGCTCAAGGACAGAAAGAAGATAGTTCAGGCCGATTGGAACCTATTGGTACCAAACCGATCGGATTCATAACTAATCTGTATTGCATTTGA

Protein Analysis

114

Amino Acids

12.78

Weight (kDa)

5.37

Isoelectric Point (pI)

41.24

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
PPR_1 PF12854 19 - 48 5.4e-06 PPR repeat
PPR_2 PF13041 20 - 66 5.8e-09 PPR repeat family
PPR PF01535 22 - 51 1.6e-08 PPR repeat
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0029554)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr1g0379071
rosa_multiflora Rmu_ssc0000136.1_g000017

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 72
Acc65I GGTACC 1 cut(s) 302
AccB1I GGYRCC 1 cut(s) 302
AcsI RAATTY 1 cut(s) 167
AfaI GTAC 1 cut(s) 304
AhlI ACTAGT 1 cut(s) 179
AluBI AGCT 2 cut(s) 160, 257
AluI AGCT 2 cut(s) 160, 257
AoxI GGCC 1 cut(s) 283
ApoI RAATTY 1 cut(s) 167
Asp718I GGTACC 1 cut(s) 302
BanI GGYRCC 1 cut(s) 302
BclI TGATCA 1 cut(s) 40
BcuI ACTAGT 1 cut(s) 179
BfaI CTAG 1 cut(s) 180
BmiI GGNNCC 2 cut(s) 294, 304
BmsI GCATC 1 cut(s) 36
BpuEI CTTGAG 1 cut(s) 243
BseRI GAGGAG 1 cut(s) 161
Bsh1285I CGRYCG 1 cut(s) 315
BshFI GGCC 1 cut(s) 285
BshNI GGYRCC 1 cut(s) 302
BsiEI CGRYCG 1 cut(s) 315
BsnI GGCC 1 cut(s) 285
Bsp143I GATC 2 cut(s) 40, 312
BspANI GGCC 1 cut(s) 285
BspLI GGNNCC 2 cut(s) 294, 304
BspT107I GGYRCC 1 cut(s) 302
BssMI GATC 2 cut(s) 40, 312
BstC8I GCNNGC 1 cut(s) 88
BstKTI GATC 2 cut(s) 43, 315
BstMBI GATC 2 cut(s) 40, 312
BstMCI CGRYCG 1 cut(s) 315
BstMWI GCNNNNNNNGC 1 cut(s) 83
BstNSI RCATGY 1 cut(s) 228
BsuRI GGCC 1 cut(s) 285
Cac8I GCNNGC 1 cut(s) 88
Csp6I GTAC 1 cut(s) 303
CviAII CATG 1 cut(s) 225
CviJI RGCY 7 cut(s) 26, 86, 90, 160, 212, 257, 285
CviKI_1 RGCY 7 cut(s) 26, 86, 90, 160, 212, 257, 285
CviQI GTAC 1 cut(s) 303
DpnI GATC 2 cut(s) 42, 314
DpnII GATC 2 cut(s) 40, 312
DraI TTTAAA 1 cut(s) 238
EcoRI GAATTC 1 cut(s) 167
FaeI CATG 1 cut(s) 228
FaiI YATR 7 cut(s) 72, 134, 155, 209, 226, 232, 323
FatI CATG 1 cut(s) 224
FbaI TGATCA 1 cut(s) 40
FspBI CTAG 1 cut(s) 180
HaeIII GGCC 1 cut(s) 285
Hin1II CATG 1 cut(s) 228
HinfI GANTC 1 cut(s) 318
Hpy188I TCNGA 3 cut(s) 45, 177, 317
HpyAV CCTTC 1 cut(s) 101
HpyCH4V TGCA 2 cut(s) 224, 339
HpyF10VI GCNNNNNNNGC 1 cut(s) 83
Hsp92II CATG 1 cut(s) 228
KpnI GGTACC 1 cut(s) 306
Ksp22I TGATCA 1 cut(s) 40
Kzo9I GATC 2 cut(s) 40, 312
LmnI GCTCC 1 cut(s) 157
LpnPI CCDG 3 cut(s) 63, 72, 267
LweI GCATC 1 cut(s) 36
MaeI CTAG 1 cut(s) 180
MalI GATC 2 cut(s) 42, 314
MboI GATC 2 cut(s) 40, 312
MboII GAAGA 2 cut(s) 262, 284
MluCI AATT 3 cut(s) 58, 125, 167
MnlI CCTC 4 cut(s) 48, 108, 139, 142
MseI TTAA 1 cut(s) 237
MwoI GCNNNNNNNGC 1 cut(s) 83
NdeII GATC 2 cut(s) 40, 312
NlaIII CATG 1 cut(s) 228
NlaIV GGNNCC 2 cut(s) 294, 304
NspI RCATGY 1 cut(s) 228
PfeI GAWTC 1 cut(s) 318
Ple19I CGATCG 1 cut(s) 315
PsiI TTATAA 1 cut(s) 72
PspN4I GGNNCC 2 cut(s) 294, 304
PvuI CGATCG 1 cut(s) 315
RsaI GTAC 1 cut(s) 304
RsaNI GTAC 1 cut(s) 303
SaqAI TTAA 1 cut(s) 237
Sau3AI GATC 2 cut(s) 40, 312
SetI ASST 4 cut(s) 112, 162, 259, 298
SfaNI GCATC 1 cut(s) 36
SgeI CNNG 7 cut(s) 62, 99, 192, 207, 237, 272, 294
SmlI CTYRAG 1 cut(s) 258
SmoI CTYRAG 1 cut(s) 258
SpeI ACTAGT 1 cut(s) 179
Sse9I AATT 3 cut(s) 58, 125, 167
SspMI CTAG 1 cut(s) 180
TaqI TCGA 1 cut(s) 97
TasI AATT 3 cut(s) 58, 125, 167
TfiI GAWTC 1 cut(s) 318
Tru1I TTAA 1 cut(s) 237
Tru9I TTAA 1 cut(s) 237
TspDTI ATGAA 1 cut(s) 310
XapI RAATTY 1 cut(s) 167
XceI RCATGY 1 cut(s) 228
XspI CTAG 1 cut(s) 180
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.