Basic Information

Type: gene

Biological Identity

Species

rosa_chinensis

Chromosome

Orthogroup ID

OG0029554

Physical Location & Seq

Genomic Coordinates Reverse (-)

65245287 .. 65245673

Gene Structure 387 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

PRQ60242

Sequence Viewer

CDS Protein Promoter (2k)

Length: 345 bp

ATGGACTTTGGGTTGGTGGGGTTGGCTGTGGAGATGTTTGATCAGATGCCAGAGAGGAATTGTTTTTCTTATAATGCTCTAATGGCTGGCTTTTGTCGAAATGGGGAAGGTTTGAGGGCATTGGAATTATTTATGAGAATGGTGGAGGAGGGTATGGAGCTGATAGAATTCACTCTGACTAGTGTTATTGGTGCTTGTGGATTGCTTATGGCTTTTCACTTTGCATGTTTATATTTTAAAAGGAGTAAGAAGATAGCTCAAGGACAGAAAGAAGATAGTTCAGGCCGATTGGAACCTATTGGTACCAAACCGATCGGATTCATAACTAATCTGTATTGCATTTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0000003 GO:0003006 GO:0003674 GO:0003676 GO:0003723 GO:0003824 GO:0004518 GO:0004519 GO:0005488 GO:0005575 GO:0005622 GO:0005623 GO:0006139 GO:0006725 GO:0006807 GO:0007275 GO:0008150 GO:0008152 GO:0009451 GO:0009790 GO:0009791 GO:0009793 GO:0009987 GO:0010154 GO:0016070 GO:0016787 GO:0016788 GO:0022414 GO:0032501 GO:0032502 GO:0034641 GO:0043170 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0043412 GO:0044237 GO:0044238 GO:0044424 GO:0044464 GO:0046483 GO:0048316 GO:0048608 GO:0048731 GO:0048856 GO:0061458 GO:0071704 GO:0090304 GO:0090305 GO:0097159 GO:1901360 GO:1901363

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

DYW_deaminase PPR PPR_2

Protein Analysis

114

Amino Acids

12.78

Weight (kDa)

5.37

Isoelectric Point (pI)

41.24

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
PPR_1	PF12854	19 - 48	5.4e-06	PPR repeat
PPR_2	PF13041	20 - 66	5.8e-09	PPR repeat family
PPR	PF01535	22 - 51	1.6e-08	PPR repeat

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0029554)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr1g0379071
rosa_multiflora	Rmu_ssc0000136.1_g000017

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	72
Acc65I	GGTACC	1 cut(s)	302
AccB1I	GGYRCC	1 cut(s)	302
AcsI	RAATTY	1 cut(s)	167
AfaI	GTAC	1 cut(s)	304
AhlI	ACTAGT	1 cut(s)	179
AluBI	AGCT	2 cut(s)	160, 257
AluI	AGCT	2 cut(s)	160, 257
AoxI	GGCC	1 cut(s)	283
ApoI	RAATTY	1 cut(s)	167
Asp718I	GGTACC	1 cut(s)	302
BanI	GGYRCC	1 cut(s)	302
BclI	TGATCA	1 cut(s)	40
BcuI	ACTAGT	1 cut(s)	179
BfaI	CTAG	1 cut(s)	180
BmiI	GGNNCC	2 cut(s)	294, 304
BmsI	GCATC	1 cut(s)	36
BpuEI	CTTGAG	1 cut(s)	243
BseRI	GAGGAG	1 cut(s)	161
Bsh1285I	CGRYCG	1 cut(s)	315
BshFI	GGCC	1 cut(s)	285
BshNI	GGYRCC	1 cut(s)	302
BsiEI	CGRYCG	1 cut(s)	315
BsnI	GGCC	1 cut(s)	285
Bsp143I	GATC	2 cut(s)	40, 312
BspANI	GGCC	1 cut(s)	285
BspLI	GGNNCC	2 cut(s)	294, 304
BspT107I	GGYRCC	1 cut(s)	302
BssMI	GATC	2 cut(s)	40, 312
BstC8I	GCNNGC	1 cut(s)	88
BstKTI	GATC	2 cut(s)	43, 315
BstMBI	GATC	2 cut(s)	40, 312
BstMCI	CGRYCG	1 cut(s)	315
BstMWI	GCNNNNNNNGC	1 cut(s)	83
BstNSI	RCATGY	1 cut(s)	228
BsuRI	GGCC	1 cut(s)	285
Cac8I	GCNNGC	1 cut(s)	88
Csp6I	GTAC	1 cut(s)	303
CviAII	CATG	1 cut(s)	225
CviJI	RGCY	7 cut(s)	26, 86, 90, 160, 212, 257, 285
CviKI_1	RGCY	7 cut(s)	26, 86, 90, 160, 212, 257, 285
CviQI	GTAC	1 cut(s)	303
DpnI	GATC	2 cut(s)	42, 314
DpnII	GATC	2 cut(s)	40, 312
DraI	TTTAAA	1 cut(s)	238
EcoRI	GAATTC	1 cut(s)	167
FaeI	CATG	1 cut(s)	228
FaiI	YATR	7 cut(s)	72, 134, 155, 209, 226, 232, 323
FatI	CATG	1 cut(s)	224
FbaI	TGATCA	1 cut(s)	40
FspBI	CTAG	1 cut(s)	180
HaeIII	GGCC	1 cut(s)	285
Hin1II	CATG	1 cut(s)	228
HinfI	GANTC	1 cut(s)	318
Hpy188I	TCNGA	3 cut(s)	45, 177, 317
HpyAV	CCTTC	1 cut(s)	101
HpyCH4V	TGCA	2 cut(s)	224, 339
HpyF10VI	GCNNNNNNNGC	1 cut(s)	83
Hsp92II	CATG	1 cut(s)	228
KpnI	GGTACC	1 cut(s)	306
Ksp22I	TGATCA	1 cut(s)	40
Kzo9I	GATC	2 cut(s)	40, 312
LmnI	GCTCC	1 cut(s)	157
LpnPI	CCDG	3 cut(s)	63, 72, 267
LweI	GCATC	1 cut(s)	36
MaeI	CTAG	1 cut(s)	180
MalI	GATC	2 cut(s)	42, 314
MboI	GATC	2 cut(s)	40, 312
MboII	GAAGA	2 cut(s)	262, 284
MluCI	AATT	3 cut(s)	58, 125, 167
MnlI	CCTC	4 cut(s)	48, 108, 139, 142
MseI	TTAA	1 cut(s)	237
MwoI	GCNNNNNNNGC	1 cut(s)	83
NdeII	GATC	2 cut(s)	40, 312
NlaIII	CATG	1 cut(s)	228
NlaIV	GGNNCC	2 cut(s)	294, 304
NspI	RCATGY	1 cut(s)	228
PfeI	GAWTC	1 cut(s)	318
Ple19I	CGATCG	1 cut(s)	315
PsiI	TTATAA	1 cut(s)	72
PspN4I	GGNNCC	2 cut(s)	294, 304
PvuI	CGATCG	1 cut(s)	315
RsaI	GTAC	1 cut(s)	304
RsaNI	GTAC	1 cut(s)	303
SaqAI	TTAA	1 cut(s)	237
Sau3AI	GATC	2 cut(s)	40, 312
SetI	ASST	4 cut(s)	112, 162, 259, 298
SfaNI	GCATC	1 cut(s)	36
SgeI	CNNG	7 cut(s)	62, 99, 192, 207, 237, 272, 294
SmlI	CTYRAG	1 cut(s)	258
SmoI	CTYRAG	1 cut(s)	258
SpeI	ACTAGT	1 cut(s)	179
Sse9I	AATT	3 cut(s)	58, 125, 167
SspMI	CTAG	1 cut(s)	180
TaqI	TCGA	1 cut(s)	97
TasI	AATT	3 cut(s)	58, 125, 167
TfiI	GAWTC	1 cut(s)	318
Tru1I	TTAA	1 cut(s)	237
Tru9I	TTAA	1 cut(s)	237
TspDTI	ATGAA	1 cut(s)	310
XapI	RAATTY	1 cut(s)	167
XceI	RCATGY	1 cut(s)	228
XspI	CTAG	1 cut(s)	180

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.