RchiOBHm_Chr1g0332301

Auxin-induced protein 5NG4

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Forward (+)
23451987 .. 23454737
2751 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ56122

Sequence Viewer

Length: 147 bp
ATGTTTGTAGCAGGGATGAACTTGCTTTCGAAAGCGATTCTGAGTGAGGGAAGCTTCATTTTTGCACTCATGGAGTATCGGCATGTGGTTGCGGCCATTTGTGTTGCTTTGCGCTCTCTTTGGAAAGGATCAAGGAACAGAAGCTAG

Protein Analysis

48

Amino Acids

5.35

Weight (kDa)

10.28

Isoelectric Point (pI)

48.8

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0029545)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr1g0332301
rosa_samantha Rh5CG230900

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 92
AclWI GGATC 1 cut(s) 136
AcoI YGGCCR 1 cut(s) 93
AluBI AGCT 2 cut(s) 54, 144
AluI AGCT 2 cut(s) 54, 144
AlwI GGATC 1 cut(s) 136
AoxI GGCC 1 cut(s) 93
AspLEI GCGC 1 cut(s) 114
AsuII TTCGAA 1 cut(s) 29
BfaI CTAG 1 cut(s) 145
BisI GCNGC 1 cut(s) 93
BlsI GCNGC 1 cut(s) 94
Bpu14I TTCGAA 1 cut(s) 29
BseGI GGATG 1 cut(s) 21
BseMII CTCAG 1 cut(s) 32
BshFI GGCC 1 cut(s) 95
BsnI GGCC 1 cut(s) 95
Bsp119I TTCGAA 1 cut(s) 29
Bsp143I GATC 1 cut(s) 128
BspACI CCGC 1 cut(s) 92
BspANI GGCC 1 cut(s) 95
BspCNI CTCAG 1 cut(s) 33
BspPI GGATC 1 cut(s) 136
BspT104I TTCGAA 1 cut(s) 29
BssMI GATC 1 cut(s) 128
BstBI TTCGAA 1 cut(s) 29
BstDEI CTNAG 1 cut(s) 41
BstF5I GGATG 1 cut(s) 21
BstHHI GCGC 1 cut(s) 114
BstKTI GATC 1 cut(s) 131
BstMBI GATC 1 cut(s) 128
BstNSI RCATGY 1 cut(s) 86
BsuRI GGCC 1 cut(s) 95
BtsCI GGATG 1 cut(s) 21
CfoI GCGC 1 cut(s) 114
CviAII CATG 2 cut(s) 70, 83
CviJI RGCY 3 cut(s) 54, 95, 144
CviKI_1 RGCY 3 cut(s) 54, 95, 144
DdeI CTNAG 1 cut(s) 41
DpnI GATC 1 cut(s) 130
DpnII GATC 1 cut(s) 128
EaeI YGGCCR 1 cut(s) 93
FaeI CATG 2 cut(s) 73, 86
FaiI YATR 2 cut(s) 71, 84
FatI CATG 2 cut(s) 69, 82
Fnu4HI GCNGC 1 cut(s) 93
FokI GGATG 1 cut(s) 28
Fsp4HI GCNGC 1 cut(s) 93
FspBI CTAG 1 cut(s) 145
GlaI GCGC 1 cut(s) 113
GluI GCNGC 1 cut(s) 93
HaeIII GGCC 1 cut(s) 95
HhaI GCGC 1 cut(s) 114
Hin1II CATG 2 cut(s) 73, 86
Hin6I GCGC 1 cut(s) 112
HinP1I GCGC 1 cut(s) 112
HindIII AAGCTT 1 cut(s) 52
HinfI GANTC 1 cut(s) 37
Hpy188I TCNGA 1 cut(s) 42
HpyCH4V TGCA 1 cut(s) 65
HpyF3I CTNAG 1 cut(s) 41
Hsp92II CATG 2 cut(s) 73, 86
HspAI GCGC 1 cut(s) 112
Kzo9I GATC 1 cut(s) 128
MaeI CTAG 1 cut(s) 145
MalI GATC 1 cut(s) 130
MboI GATC 1 cut(s) 128
MnlI CCTC 1 cut(s) 40
NdeII GATC 1 cut(s) 128
NlaIII CATG 2 cut(s) 73, 86
NspI RCATGY 1 cut(s) 86
NspV TTCGAA 1 cut(s) 29
PfeI GAWTC 1 cut(s) 37
PkrI GCNGC 1 cut(s) 94
SatI GCNGC 1 cut(s) 93
Sau3AI GATC 1 cut(s) 128
SetI ASST 2 cut(s) 56, 146
SfuI TTCGAA 1 cut(s) 29
SgeI CNNG 4 cut(s) 24, 34, 82, 95
SsiI CCGC 1 cut(s) 92
SspMI CTAG 1 cut(s) 145
TaqI TCGA 1 cut(s) 29
TauI GCSGC 1 cut(s) 95
TfiI GAWTC 1 cut(s) 37
TspDTI ATGAA 2 cut(s) 32, 46
XceI RCATGY 1 cut(s) 86
XspI CTAG 1 cut(s) 145
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.