RchiOBHm_Chr1g0356721

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Forward (+)
49149402 .. 49149994
593 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ58204

Sequence Viewer

Length: 171 bp
ATGGGAAACAAGTCATCAAGGACAATCCAAAAAACATCTGGAACAAGACGAGTTATGGTGTGTTTGATTCTTCAGGTTTTGGATGCAAGACTATTTCTATCTAGATCTAGTGGATTGGTTTTCGCATATAATATATTGGCTGTGGGTTTGGGAATCTATTTATTTGTGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

56

Amino Acids

6.18

Weight (kDa)

10.95

Isoelectric Point (pI)

62.46

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0029690)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr1g0356721 RchiOBHm_Chr3g0467481

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 56
BfaI CTAG 2 cut(s) 102, 108
BglII AGATCT 1 cut(s) 104
BmsI GCATC 1 cut(s) 73
BseGI GGATG 1 cut(s) 88
Bsp143I GATC 1 cut(s) 104
BssMI GATC 1 cut(s) 104
BstF5I GGATG 1 cut(s) 88
BstKTI GATC 1 cut(s) 107
BstMBI GATC 1 cut(s) 104
BstX2I RGATCY 1 cut(s) 104
BstYI RGATCY 1 cut(s) 104
BtsCI GGATG 1 cut(s) 88
CviJI RGCY 1 cut(s) 140
CviKI_1 RGCY 1 cut(s) 140
DpnI GATC 1 cut(s) 106
DpnII GATC 1 cut(s) 104
Eco57I CTGAAG 1 cut(s) 56
FaiI YATR 4 cut(s) 56, 127, 129, 134
FokI GGATG 1 cut(s) 95
FspBI CTAG 2 cut(s) 102, 108
HinfI GANTC 2 cut(s) 67, 153
Hpy188III TCNNGA 2 cut(s) 39, 102
HpyCH4V TGCA 1 cut(s) 86
Kzo9I GATC 1 cut(s) 104
LpnPI CCDG 2 cut(s) 24, 59
LweI GCATC 1 cut(s) 73
MaeI CTAG 2 cut(s) 102, 108
MalI GATC 1 cut(s) 106
MboI GATC 1 cut(s) 104
MboII GAAGA 1 cut(s) 62
MflI RGATCY 1 cut(s) 104
NdeII GATC 1 cut(s) 104
PfeI GAWTC 2 cut(s) 67, 153
PsuI RGATCY 1 cut(s) 104
Sau3AI GATC 1 cut(s) 104
SetI ASST 1 cut(s) 78
SfaNI GCATC 1 cut(s) 73
SgeI CNNG 9 cut(s) 22, 30, 51, 57, 62, 86, 99, 114, 120
SspMI CTAG 2 cut(s) 102, 108
TfiI GAWTC 2 cut(s) 67, 153
XbaI TCTAGA 1 cut(s) 101
XcmI CCANNNNNNNNNTGG 1 cut(s) 35
XspI CTAG 2 cut(s) 102, 108
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.