RchiOBHm_Chr1g0361581
NAC Family

NAC domain-containing protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Reverse (-)
53475841 .. 53476271
431 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ58644

Sequence Viewer

Length: 183 bp
ATGTCTGATTTTGAACATCAAGCTACAGATTCTAGGATTCTAGAGGTGCATCGTCAAACCAAAGAAAATATGGAGTCAGCATTTTATCCATTTCAGCCACAAGATTCAGCTCTGCAGTCAATGATGTACATAATGCATGGAGATGCTCCGCATAATATTGAATGCAATGAGTTGCAATCTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

60

Amino Acids

7.02

Weight (kDa)

4.65

Isoelectric Point (pI)

120.16

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0029641)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr1g0361581
rosa_samantha Rh1CG281700

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 149
AfaI GTAC 1 cut(s) 128
AgsI TTSAA 2 cut(s) 14, 161
AluBI AGCT 2 cut(s) 23, 110
AluI AGCT 2 cut(s) 23, 110
BfaI CTAG 2 cut(s) 33, 41
BfmI CTRYAG 2 cut(s) 24, 113
BmsI GCATC 2 cut(s) 58, 133
Bse3DI GCAATG 1 cut(s) 172
BseMI GCAATG 1 cut(s) 172
BsmI GAATGC 1 cut(s) 167
Bsp1407I TGTACA 1 cut(s) 126
BspACI CCGC 1 cut(s) 149
BspMAI CTGCAG 1 cut(s) 117
BsrDI GCAATG 1 cut(s) 172
BsrGI TGTACA 1 cut(s) 126
BstAUI TGTACA 1 cut(s) 126
BstSFI CTRYAG 2 cut(s) 24, 113
Csp6I GTAC 1 cut(s) 127
CviAII CATG 1 cut(s) 137
CviJI RGCY 3 cut(s) 23, 97, 110
CviKI_1 RGCY 3 cut(s) 23, 97, 110
CviQI GTAC 1 cut(s) 127
EcoT22I ATGCAT 1 cut(s) 138
FaeI CATG 1 cut(s) 140
FaiI YATR 4 cut(s) 71, 131, 138, 153
FatI CATG 1 cut(s) 136
FspBI CTAG 2 cut(s) 33, 41
FspEI CC 8 cut(s) 19, 29, 56, 73, 102, 111, 123, 162
Hin1II CATG 1 cut(s) 140
HinfI GANTC 4 cut(s) 29, 37, 74, 104
Hpy188I TCNGA 1 cut(s) 7
Hpy188III TCNNGA 1 cut(s) 41
HpyCH4V TGCA 5 cut(s) 49, 115, 136, 165, 175
Hsp92II CATG 1 cut(s) 140
LmnI GCTCC 1 cut(s) 151
LweI GCATC 2 cut(s) 58, 133
MaeI CTAG 2 cut(s) 33, 41
MlyI GAGTC 1 cut(s) 83
MnlI CCTC 1 cut(s) 37
Mph1103I ATGCAT 1 cut(s) 138
MseI TTAA 1 cut(s) 181
MslI CAYNNNNRTG 1 cut(s) 141
Mva1269I GAATGC 1 cut(s) 167
NlaIII CATG 1 cut(s) 140
NsiI ATGCAT 1 cut(s) 138
PctI GAATGC 1 cut(s) 167
PfeI GAWTC 3 cut(s) 29, 37, 104
PleI GAGTC 1 cut(s) 82
PpsI GAGTC 1 cut(s) 82
PstI CTGCAG 1 cut(s) 117
RsaI GTAC 1 cut(s) 128
RsaNI GTAC 1 cut(s) 127
RseI CAYNNNNRTG 1 cut(s) 141
SaqAI TTAA 1 cut(s) 181
SchI GAGTC 1 cut(s) 83
SetI ASST 3 cut(s) 25, 48, 112
SfaNI GCATC 2 cut(s) 58, 133
SfcI CTRYAG 2 cut(s) 24, 113
SgeI CNNG 5 cut(s) 32, 45, 53, 113, 149
SmiMI CAYNNNNRTG 1 cut(s) 141
SsiI CCGC 1 cut(s) 149
SspI AATATT 1 cut(s) 157
SspMI CTAG 2 cut(s) 33, 41
TatI WGTACW 1 cut(s) 126
TfiI GAWTC 3 cut(s) 29, 37, 104
Tru1I TTAA 1 cut(s) 181
Tru9I TTAA 1 cut(s) 181
XbaI TCTAGA 1 cut(s) 40
XcmI CCANNNNNNNNNTGG 1 cut(s) 67
XspI CTAG 2 cut(s) 33, 41
Zsp2I ATGCAT 1 cut(s) 138
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.