RchiOBHm_Chr2g0114581

ribosome biogenesis protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Reverse (-)
26480881 .. 26481234
354 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ48779

Sequence Viewer

Length: 156 bp
ATGTCATATGCGAAGGAATTTGTTAATAAATATGGAGGCAATTGTGGCCGAGTTCAATCCAAAGAAAGTGATTATTTTGATGAGCTGAAGGAGGAGATTGAACTGCAGAAAGAGATGAACAAAGCTGAACTCAATGACATTGACGAGGATACCTGA

Protein Analysis

51

Amino Acids

5.98

Weight (kDa)

4.33

Isoelectric Point (pI)

70.03

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0029873)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr2g0114581
rosa_samantha Rh2CG252300

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 46
AcsI RAATTY 1 cut(s) 17
AcuI CTGAAG 1 cut(s) 107
AgsI TTSAA 2 cut(s) 56, 101
AluBI AGCT 2 cut(s) 85, 125
AluI AGCT 2 cut(s) 85, 125
AoxI GGCC 1 cut(s) 46
ApoI RAATTY 1 cut(s) 17
BciVI GTATCC 1 cut(s) 142
BfmI CTRYAG 1 cut(s) 104
BfuI GTATCC 1 cut(s) 142
BseRI GAGGAG 1 cut(s) 107
BshFI GGCC 1 cut(s) 48
BsnI GGCC 1 cut(s) 48
BspANI GGCC 1 cut(s) 48
BspMAI CTGCAG 1 cut(s) 108
BstMWI GCNNNNNNNGC 1 cut(s) 45
BstSFI CTRYAG 1 cut(s) 104
BsuI GTATCC 1 cut(s) 142
BsuRI GGCC 1 cut(s) 48
CviJI RGCY 3 cut(s) 48, 85, 125
CviKI_1 RGCY 3 cut(s) 48, 85, 125
EaeI YGGCCR 1 cut(s) 46
Eco57I CTGAAG 1 cut(s) 107
FaiI YATR 3 cut(s) 7, 9, 33
FauNDI CATATG 1 cut(s) 7
FspEI CC 8 cut(s) 18, 21, 30, 62, 73, 74, 77, 131
HaeIII GGCC 1 cut(s) 48
HpyAV CCTTC 2 cut(s) 7, 82
HpyCH4V TGCA 1 cut(s) 106
HpyF10VI GCNNNNNNNGC 1 cut(s) 45
MfeI CAATTG 1 cut(s) 40
MluCI AATT 2 cut(s) 17, 40
MnlI CCTC 3 cut(s) 29, 85, 139
MseI TTAA 1 cut(s) 24
MunI CAATTG 1 cut(s) 40
MwoI GCNNNNNNNGC 1 cut(s) 45
NdeI CATATG 1 cut(s) 7
NmeAIII GCCGAG 1 cut(s) 74
PstI CTGCAG 1 cut(s) 108
SaqAI TTAA 1 cut(s) 24
SetI ASST 3 cut(s) 87, 127, 155
SfcI CTRYAG 1 cut(s) 104
SgeI CNNG 1 cut(s) 62
Sse9I AATT 2 cut(s) 17, 40
TasI AATT 2 cut(s) 17, 40
Tru1I TTAA 1 cut(s) 24
Tru9I TTAA 1 cut(s) 24
TspDTI ATGAA 1 cut(s) 131
XapI RAATTY 1 cut(s) 17
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.