RchiOBHm_Chr2g0118021

Pentatricopeptide repeat-containing protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Forward (+)
30363278 .. 30363810
533 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ49088

Sequence Viewer

Length: 252 bp
ATGATTGTGGGTTGTGCACTTTGTTTGGGTTTGTTGAAAGAGATGAAAGACAGTTTGTGCCTGCCAGATCAGTGGACTTTCAGTGCACTCATAAAAGCTTGCGGTGAAGCATTAGAATTTCGGCGTGGTTGCGTGCTTTTATCATCAAAAATGTGGTTGGAGATCTTCTGTGTTGGTGAAGAACTCCTTTTAAGTATTTATGCTGAATTAGGTTGCCTGGTGAATGCAGTAAATGTGTTCAAGTCTGGTTGA

Protein Analysis

83

Amino Acids

9.11

Weight (kDa)

4.93

Isoelectric Point (pI)

37.7

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0029750)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr2g0118021
rosa_roxburghii Rroxscaffold_2G00126050

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 102
AcsI RAATTY 1 cut(s) 116
AgsI TTSAA 2 cut(s) 37, 241
AjnI CCWGG 1 cut(s) 216
AluBI AGCT 1 cut(s) 98
AluI AGCT 1 cut(s) 98
Alw21I GWGCWC 2 cut(s) 19, 88
Alw44I GTGCAC 2 cut(s) 15, 84
ApaLI GTGCAC 2 cut(s) 15, 84
ApoI RAATTY 1 cut(s) 116
AsuHPI GGTGA 3 cut(s) 116, 188, 232
BaeGI GKGCMC 2 cut(s) 19, 88
Bbv12I GWGCWC 2 cut(s) 19, 88
BciT130I CCWGG 1 cut(s) 218
BglII AGATCT 1 cut(s) 162
Bme1390I CCNGG 1 cut(s) 218
BmrFI CCNGG 1 cut(s) 218
BseBI CCWGG 1 cut(s) 218
BseSI GKGCMC 2 cut(s) 19, 88
BsiHKAI GWGCWC 2 cut(s) 19, 88
BsmI GAATGC 1 cut(s) 229
Bsp1286I GDGCHC 2 cut(s) 19, 88
Bsp143I GATC 2 cut(s) 67, 162
BspACI CCGC 1 cut(s) 102
BssMI GATC 2 cut(s) 67, 162
Bst2UI CCWGG 1 cut(s) 218
Bst4CI ACNGT 1 cut(s) 53
BstC8I GCNNGC 3 cut(s) 62, 100, 134
BstKTI GATC 2 cut(s) 70, 165
BstMBI GATC 2 cut(s) 67, 162
BstNI CCWGG 1 cut(s) 218
BstSCI CCNGG 1 cut(s) 216
BstSLI GKGCMC 2 cut(s) 19, 88
BstX2I RGATCY 1 cut(s) 162
BstXI CCANNNNNNTGG 1 cut(s) 72
BstYI RGATCY 1 cut(s) 162
BtsIMutI CAGTG 2 cut(s) 77, 88
Cac8I GCNNGC 3 cut(s) 62, 100, 134
CviJI RGCY 1 cut(s) 98
CviKI_1 RGCY 1 cut(s) 98
DpnI GATC 2 cut(s) 69, 164
DpnII GATC 2 cut(s) 67, 162
EcoRII CCWGG 1 cut(s) 216
FaiI YATR 2 cut(s) 92, 201
FalI AAGNNNNNCTT 2 cut(s) 171, 203
HindIII AAGCTT 1 cut(s) 96
HphI GGTGA 3 cut(s) 116, 188, 232
Hpy166II GTNNAC 3 cut(s) 17, 75, 86
Hpy8I GTNNAC 3 cut(s) 17, 75, 86
HpyCH4III ACNGT 1 cut(s) 53
HpyCH4V TGCA 3 cut(s) 17, 86, 227
Kzo9I GATC 2 cut(s) 67, 162
LpnPI CCDG 5 cut(s) 74, 78, 203, 230, 231
MalI GATC 2 cut(s) 69, 164
MboI GATC 2 cut(s) 67, 162
MboII GAAGA 2 cut(s) 157, 191
MflI RGATCY 1 cut(s) 162
MhlI GDGCHC 2 cut(s) 19, 88
MluCI AATT 2 cut(s) 116, 206
MmeI TCCRAC 1 cut(s) 138
MseI TTAA 1 cut(s) 191
MspR9I CCNGG 1 cut(s) 218
Mva1269I GAATGC 1 cut(s) 229
MvaI CCWGG 1 cut(s) 218
NdeII GATC 2 cut(s) 67, 162
PctI GAATGC 1 cut(s) 229
Psp6I CCWGG 1 cut(s) 216
PspGI CCWGG 1 cut(s) 216
PsuI RGATCY 1 cut(s) 162
SaqAI TTAA 1 cut(s) 191
Sau3AI GATC 2 cut(s) 67, 162
ScrFI CCNGG 1 cut(s) 218
SduI GDGCHC 2 cut(s) 19, 88
SetI ASST 2 cut(s) 100, 214
SgeI CNNG 7 cut(s) 73, 77, 111, 137, 145, 229, 230
Sse9I AATT 2 cut(s) 116, 206
SsiI CCGC 1 cut(s) 102
StyD4I CCNGG 1 cut(s) 216
TaaI ACNGT 1 cut(s) 53
TasI AATT 2 cut(s) 116, 206
Tru1I TTAA 1 cut(s) 191
Tru9I TTAA 1 cut(s) 191
TscAI CASTG 2 cut(s) 77, 88
TspDTI ATGAA 1 cut(s) 59
TspRI CASTG 2 cut(s) 77, 88
VneI GTGCAC 2 cut(s) 15, 84
XapI RAATTY 1 cut(s) 116
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.