RchiOBHm_Chr3g0481361

TMV resistance protein N-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
3
OG0022705
Physical Location & Seq
Forward (+)
27418377 .. 27422277
3901 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ44633

Sequence Viewer

Length: 372 bp
ATGGCCTTTATCCGATGGCAAGATATCGACAGACTTTTAGATATGGAGAAAAGTAATGTTCGCATTGTAGGTATACGAGGGATTGGAGGAATAGGAAAGATCACATTTGCTAAGGCCATATTCAATTCAAGTCGCCCTAAGTTTAAAAATAGCTGTTTTTTGACAGATGTTATATCAACTTCAATGCCACATCGAGGGCTCTCCCAACTGCAAGAGACTCATTTGTTTGTTATCTTAGGGGACTCAAAATTGAAGGTGAGTGATTGTAATGTAGGAGTCAATTTGATAATGAAAATGATGCAACACAAGAAACTTATCTTAATCCTTGATGATGTGAGCAGTTCGGAGATATTAGATAACTTAGCTCCATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko04014 map04014
Pfam Domains
Protein Families
NB-ARC TIR

Protein Analysis

123

Amino Acids

13.77

Weight (kDa)

9.3

Isoelectric Point (pI)

43.74

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
NB-ARC PF00931 15 - 121 3.2e-10 NB-ARC domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0022705)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr3g0481361
rosa_laevigata RLG00000023403
rosa_roxburghii Rroxscaffold_6G00400480
rosa_wichuraiana Rw3G021660

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 73
AfiI CCNNNNNNNGG 1 cut(s) 194
AgsI TTSAA 4 cut(s) 124, 129, 183, 253
AluBI AGCT 2 cut(s) 153, 365
AluI AGCT 2 cut(s) 153, 365
Alw26I GTCTC 1 cut(s) 209
AoxI GGCC 2 cut(s) 3, 114
AsuHPI GGTGA 1 cut(s) 268
BanII GRGCYC 1 cut(s) 201
BccI CCATC 1 cut(s) 9
BcoDI GTCTC 1 cut(s) 209
BmsI GCATC 1 cut(s) 288
Bpu10I CCTNAGC 1 cut(s) 111
Bsc4I CCNNNNNNNGG 1 cut(s) 194
BseLI CCNNNNNNNGG 1 cut(s) 194
BshFI GGCC 2 cut(s) 5, 116
BslFI GGGAC 1 cut(s) 254
BslI CCNNNNNNNGG 1 cut(s) 194
BsmAI GTCTC 1 cut(s) 209
BsmFI GGGAC 1 cut(s) 254
BsnI GGCC 2 cut(s) 5, 116
Bsp1286I GDGCHC 1 cut(s) 201
Bsp143I GATC 1 cut(s) 99
BspANI GGCC 2 cut(s) 5, 116
BssMI GATC 1 cut(s) 99
BssNAI GTATAC 1 cut(s) 74
Bst1107I GTATAC 1 cut(s) 74
BstDEI CTNAG 4 cut(s) 111, 138, 235, 361
BstKTI GATC 1 cut(s) 102
BstMAI GTCTC 1 cut(s) 209
BstMBI GATC 1 cut(s) 99
BstZ17I GTATAC 1 cut(s) 74
BsuRI GGCC 2 cut(s) 5, 116
CviJI RGCY 5 cut(s) 5, 116, 153, 199, 365
CviKI_1 RGCY 5 cut(s) 5, 116, 153, 199, 365
DdeI CTNAG 4 cut(s) 111, 138, 235, 361
DpnI GATC 1 cut(s) 101
DpnII GATC 1 cut(s) 99
DraI TTTAAA 1 cut(s) 145
Eco24I GRGCYC 1 cut(s) 201
Eco32I GATATC 1 cut(s) 25
EcoRV GATATC 1 cut(s) 25
EcoT38I GRGCYC 1 cut(s) 201
FaiI YATR 5 cut(s) 44, 74, 119, 173, 370
FaqI GGGAC 1 cut(s) 254
FblI GTMKAC 1 cut(s) 73
FriOI GRGCYC 1 cut(s) 201
HaeIII GGCC 2 cut(s) 5, 116
HinfI GANTC 3 cut(s) 217, 242, 276
HphI GGTGA 1 cut(s) 268
Hpy166II GTNNAC 1 cut(s) 74
Hpy188I TCNGA 2 cut(s) 14, 346
Hpy8I GTNNAC 1 cut(s) 74
HpyAV CCTTC 1 cut(s) 247
HpyCH4V TGCA 2 cut(s) 211, 301
HpyF3I CTNAG 4 cut(s) 111, 138, 235, 361
Kzo9I GATC 1 cut(s) 99
LmnI GCTCC 1 cut(s) 370
LweI GCATC 1 cut(s) 288
MalI GATC 1 cut(s) 101
MboI GATC 1 cut(s) 99
MhlI GDGCHC 1 cut(s) 201
MluCI AATT 3 cut(s) 124, 248, 280
MlyI GAGTC 3 cut(s) 211, 236, 285
MnlI CCTC 3 cut(s) 71, 80, 188
MseI TTAA 2 cut(s) 144, 320
NdeII GATC 1 cut(s) 99
PleI GAGTC 3 cut(s) 211, 236, 284
PpsI GAGTC 3 cut(s) 211, 236, 284
SaqAI TTAA 2 cut(s) 144, 320
Sau3AI GATC 1 cut(s) 99
SchI GAGTC 3 cut(s) 211, 236, 285
SduI GDGCHC 1 cut(s) 201
SetI ASST 4 cut(s) 73, 155, 258, 367
SfaNI GCATC 1 cut(s) 288
SgeI CNNG 7 cut(s) 32, 89, 141, 206, 224, 319, 338
Sse9I AATT 3 cut(s) 124, 248, 280
TaqI TCGA 2 cut(s) 27, 193
TasI AATT 3 cut(s) 124, 248, 280
Tru1I TTAA 2 cut(s) 144, 320
Tru9I TTAA 2 cut(s) 144, 320
TspDTI ATGAA 1 cut(s) 305
XmiI GTMKAC 1 cut(s) 73
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.