RchiOBHm_Chr5g0006501

riboflavin kinase

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Reverse (-)
4020590 .. 4021034
445 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ28761

Sequence Viewer

Length: 300 bp
ATGGTCTTGAAGATGTCCATCGCAGAGCCATTAAAGAAATTAGTTTCATGTGTTATCCTTGATTTGGATGGTACTCTACTACACACAGATGGCATCGTAAGTGATGTTTTAAGAGTTTATTTGGGCAAGTATGGAAAGAAATGGGATGGAAGGGAACTTCAAAAGATGGTTGGAAAAACACCACTCGAAGCTGCAGCTGCTATTGTGGAGGATTATGGGCTGTCTTGCACAACGAGTGAATTAATCTCAGAGCTAAACCCAATGAGATTAACTTCTGCAGCTACTTTCAAACACCAATAA

Protein Analysis

99

Amino Acids

10.87

Weight (kDa)

6.71

Isoelectric Point (pI)

30.25

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0030211)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr5g0006501
rosa_rugosa Rorug05G0252700.1

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 73
AfiI CCNNNNNNNGG 1 cut(s) 64
AgsI TTSAA 3 cut(s) 10, 161, 289
AluBI AGCT 4 cut(s) 191, 197, 253, 281
AluI AGCT 4 cut(s) 191, 197, 253, 281
ApeKI GCWGC 4 cut(s) 191, 194, 197, 278
AseI ATTAAT 1 cut(s) 242
BbvI GCAGC 4 cut(s) 178, 184, 206, 290
BccI CCATC 5 cut(s) 26, 62, 83, 140, 160
BfmI CTRYAG 2 cut(s) 192, 276
BisI GCNGC 4 cut(s) 192, 195, 198, 279
BlsI GCNGC 4 cut(s) 193, 196, 199, 280
BmsI GCATC 1 cut(s) 102
BsaBI GATNNNNATC 1 cut(s) 17
Bsc4I CCNNNNNNNGG 1 cut(s) 64
Bse8I GATNNNNATC 1 cut(s) 17
BseGI GGATG 2 cut(s) 73, 151
BseJI GATNNNNATC 1 cut(s) 17
BseLI CCNNNNNNNGG 1 cut(s) 64
BseMII CTCAG 1 cut(s) 261
BseXI GCAGC 4 cut(s) 178, 184, 206, 290
BslI CCNNNNNNNGG 1 cut(s) 64
BspCNI CTCAG 1 cut(s) 260
BspMAI CTGCAG 2 cut(s) 196, 280
BstDEI CTNAG 1 cut(s) 247
BstF5I GGATG 2 cut(s) 73, 151
BstMWI GCNNNNNNNGC 1 cut(s) 197
BstSFI CTRYAG 2 cut(s) 192, 276
BstV1I GCAGC 4 cut(s) 178, 184, 206, 290
BtgZI GCGATG 1 cut(s) 4
BtsCI GGATG 2 cut(s) 73, 151
Csp6I GTAC 1 cut(s) 72
CviAII CATG 1 cut(s) 48
CviJI RGCY 6 cut(s) 28, 191, 197, 220, 253, 281
CviKI_1 RGCY 6 cut(s) 28, 191, 197, 220, 253, 281
CviQI GTAC 1 cut(s) 72
DdeI CTNAG 1 cut(s) 247
FaeI CATG 1 cut(s) 51
FaiI YATR 3 cut(s) 49, 132, 216
FatI CATG 1 cut(s) 47
Fnu4HI GCNGC 4 cut(s) 192, 195, 198, 279
FokI GGATG 2 cut(s) 80, 158
Fsp4HI GCNGC 4 cut(s) 192, 195, 198, 279
GluI GCNGC 4 cut(s) 192, 195, 198, 279
Hin1II CATG 1 cut(s) 51
Hpy188I TCNGA 1 cut(s) 250
Hpy188III TCNNGA 1 cut(s) 7
HpyAV CCTTC 1 cut(s) 144
HpyCH4V TGCA 3 cut(s) 194, 228, 278
HpyF10VI GCNNNNNNNGC 1 cut(s) 197
HpyF3I CTNAG 1 cut(s) 247
Hsp92II CATG 1 cut(s) 51
Lsp1109I GCAGC 4 cut(s) 178, 184, 206, 290
LweI GCATC 1 cut(s) 102
MboII GAAGA 1 cut(s) 22
MluCI AATT 2 cut(s) 38, 239
MmeI TCCRAC 1 cut(s) 151
MnlI CCTC 1 cut(s) 202
MseI TTAA 4 cut(s) 32, 110, 242, 269
MslI CAYNNNNRTG 1 cut(s) 87
MspA1I CMGCKG 1 cut(s) 197
MwoI GCNNNNNNNGC 1 cut(s) 197
NlaIII CATG 1 cut(s) 51
PkrI GCNGC 4 cut(s) 193, 196, 199, 280
PshBI ATTAAT 1 cut(s) 242
PstI CTGCAG 2 cut(s) 196, 280
PvuII CAGCTG 1 cut(s) 197
RsaI GTAC 1 cut(s) 73
RsaNI GTAC 1 cut(s) 72
RseI CAYNNNNRTG 1 cut(s) 87
SaqAI TTAA 4 cut(s) 32, 110, 242, 269
SatI GCNGC 4 cut(s) 192, 195, 198, 279
SetI ASST 4 cut(s) 193, 199, 255, 283
SfaNI GCATC 1 cut(s) 102
SfcI CTRYAG 2 cut(s) 192, 276
SgeI CNNG 7 cut(s) 19, 60, 71, 139, 197, 237, 246
SmiMI CAYNNNNRTG 1 cut(s) 87
Sse9I AATT 2 cut(s) 38, 239
TaqI TCGA 1 cut(s) 186
TasI AATT 2 cut(s) 38, 239
Tru1I TTAA 4 cut(s) 32, 110, 242, 269
Tru9I TTAA 4 cut(s) 32, 110, 242, 269
TseI GCWGC 4 cut(s) 191, 194, 197, 278
TspDTI ATGAA 1 cut(s) 36
VspI ATTAAT 1 cut(s) 242
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.