RchiOBHm_Chr5g0061161

Surfeit locus protein 6

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
OG0029954
Physical Location & Seq
Reverse (-)
66512838 .. 66513111
274 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ33755

Sequence Viewer

Length: 201 bp
ATGGGGAAAATGATGAAGAATAAAACGGATAGAGAGACCAATATTGATTCTTATCCAATTCTTTATTTGAAGTCTATTACCCATCAGCATTCTCAATTTATGGACAAGCTAGTTGATCTCATCCCTGCTCAGTTCTATTTATCCAATGACGATCGGAATAAGCCATGGTTTCAAGGCCTCATTAACCTGCAAAAGGTTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
RRP14 SURF6

Protein Analysis

66

Amino Acids

7.86

Weight (kDa)

9.05

Isoelectric Point (pI)

35.9

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
RRP14 PF15459 28 - 60 1.4e-08 60S ribosome biogenesis protein Rrp14
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0029954)

Species Orthologous Gene IDs
rosa_chinensis RchiOBHm_Chr3g0493171 RchiOBHm_Chr5g0061161

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 195
AfiI CCNNNNNNNGG 1 cut(s) 193
AgsI TTSAA 2 cut(s) 70, 173
AluBI AGCT 1 cut(s) 109
AluI AGCT 1 cut(s) 109
Alw26I GTCTC 1 cut(s) 29
AoxI GGCC 1 cut(s) 175
BccI CCATC 1 cut(s) 90
BcoDI GTCTC 1 cut(s) 29
BfaI CTAG 1 cut(s) 110
BfuAI ACCTGC 1 cut(s) 195
BsaBI GATNNNNATC 1 cut(s) 51
BsaI GGTCTC 1 cut(s) 29
BsaJI CCNNGG 1 cut(s) 164
Bsc4I CCNNNNNNNGG 1 cut(s) 193
Bse8I GATNNNNATC 1 cut(s) 51
BseDI CCNNGG 1 cut(s) 164
BseGI GGATG 1 cut(s) 120
BseJI GATNNNNATC 1 cut(s) 51
BseLI CCNNNNNNNGG 1 cut(s) 193
BseMII CTCAG 1 cut(s) 143
Bsh1285I CGRYCG 1 cut(s) 154
BshFI GGCC 1 cut(s) 177
BsiEI CGRYCG 1 cut(s) 154
BslI CCNNNNNNNGG 1 cut(s) 193
BsmAI GTCTC 1 cut(s) 29
BsmI GAATGC 1 cut(s) 88
BsnI GGCC 1 cut(s) 177
Bso31I GGTCTC 1 cut(s) 29
Bsp143I GATC 2 cut(s) 115, 151
Bsp19I CCATGG 1 cut(s) 164
BspANI GGCC 1 cut(s) 177
BspCNI CTCAG 1 cut(s) 142
BspMI ACCTGC 1 cut(s) 195
BspTNI GGTCTC 1 cut(s) 29
BssECI CCNNGG 1 cut(s) 164
BssMI GATC 2 cut(s) 115, 151
BssT1I CCWWGG 1 cut(s) 164
BstDEI CTNAG 1 cut(s) 129
BstDSI CCRYGG 1 cut(s) 164
BstENI CCTNNNNNAGG 1 cut(s) 191
BstF5I GGATG 1 cut(s) 120
BstKTI GATC 2 cut(s) 118, 154
BstMAI GTCTC 1 cut(s) 29
BstMBI GATC 2 cut(s) 115, 151
BstMCI CGRYCG 1 cut(s) 154
BsuRI GGCC 1 cut(s) 177
BtgI CCRYGG 1 cut(s) 164
BtsCI GGATG 1 cut(s) 120
BveI ACCTGC 1 cut(s) 195
CviAII CATG 1 cut(s) 165
CviJI RGCY 3 cut(s) 109, 163, 177
CviKI_1 RGCY 3 cut(s) 109, 163, 177
DdeI CTNAG 1 cut(s) 129
DpnI GATC 2 cut(s) 117, 153
DpnII GATC 2 cut(s) 115, 151
Eco130I CCWWGG 1 cut(s) 164
Eco147I AGGCCT 1 cut(s) 177
Eco31I GGTCTC 1 cut(s) 29
EcoNI CCTNNNNNAGG 1 cut(s) 191
EcoT14I CCWWGG 1 cut(s) 164
ErhI CCWWGG 1 cut(s) 164
FaeI CATG 1 cut(s) 168
FaiI YATR 2 cut(s) 101, 166
FatI CATG 1 cut(s) 164
FokI GGATG 1 cut(s) 107
FspBI CTAG 1 cut(s) 110
HaeIII GGCC 1 cut(s) 177
Hin1II CATG 1 cut(s) 168
HinfI GANTC 1 cut(s) 47
Hpy188I TCNGA 1 cut(s) 156
HpyCH4V TGCA 1 cut(s) 190
HpyF3I CTNAG 1 cut(s) 129
Hsp92II CATG 1 cut(s) 168
Kzo9I GATC 2 cut(s) 115, 151
LpnPI CCDG 1 cut(s) 138
MaeI CTAG 1 cut(s) 110
MalI GATC 2 cut(s) 117, 153
MboI GATC 2 cut(s) 115, 151
MboII GAAGA 1 cut(s) 28
MluCI AATT 2 cut(s) 57, 95
MnlI CCTC 1 cut(s) 188
MseI TTAA 1 cut(s) 183
Mva1269I GAATGC 1 cut(s) 88
NcoI CCATGG 1 cut(s) 164
NdeII GATC 2 cut(s) 115, 151
NlaIII CATG 1 cut(s) 168
PceI AGGCCT 1 cut(s) 177
PctI GAATGC 1 cut(s) 88
PfeI GAWTC 1 cut(s) 47
Ple19I CGATCG 1 cut(s) 154
PvuI CGATCG 1 cut(s) 154
SaqAI TTAA 1 cut(s) 183
Sau3AI GATC 2 cut(s) 115, 151
SetI ASST 3 cut(s) 111, 189, 198
SgeI CNNG 5 cut(s) 118, 122, 137, 177, 185
Sse9I AATT 2 cut(s) 57, 95
SseBI AGGCCT 1 cut(s) 177
SspI AATATT 1 cut(s) 43
SspMI CTAG 1 cut(s) 110
StuI AGGCCT 1 cut(s) 177
StyI CCWWGG 1 cut(s) 164
TasI AATT 2 cut(s) 57, 95
TfiI GAWTC 1 cut(s) 47
Tru1I TTAA 1 cut(s) 183
Tru9I TTAA 1 cut(s) 183
TspDTI ATGAA 1 cut(s) 29
TspGWI ACGGA 1 cut(s) 41
XagI CCTNNNNNAGG 1 cut(s) 191
XspI CTAG 1 cut(s) 110
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.